Ethics statement
This study was approved by the Institutional Animal Care and Use Committee of Tottori University (Permit numbers: 20-Y-14, 17-Y-27, and 16-Y-19) and the Recombinant DNA Experiment Safety Committee of Tottori University to perform recombinant DNA experiments. All experiments were carried out in compliance with the ARRIVE guidelines. All methods were performed in accordance with the relevant guidelines and regulations.
Cell culture
CHO cells derived from a HPRT-deficient cell line (JCRB0218) (NIBIOHN, Osaka, Japan), which contained 21HAC141, MAC243, or MAC446, were cultured in Ham’s F-12 medium (FUJIFILM Wako, Osaka, Japan) with 10% FBS, 1% penicillin/streptomycin (FUJIFILM Wako), and 800 µg/mL hygromycin B (FUJIFILM Wako). CHO cells that contained 21HAC2 were cultured in Ham’s F-12 medium with blasticidin S (FUJIFILM Wako). HEK293 cells were purchased from the ATCC (ATCC® CRL-1573™) and cultured in Eagle’s minimum essential medium (Sigma-Aldrich, St. Louis, MO, USA) with 10% fetal bovine serum (FBS, Biowest, Vieux Bourg, Nuaillé, France), 1% non-essential amino acids (Sigma-Aldrich), 1% L-glutamine (Sigma-Aldrich), and 1% penicillin/streptomycin (FUJIFILM Wako). HT1080 cells47 obtained from the ATCC (ATCC® CCL-121™) were cultured in Dulbecco’s modified Eagle’s medium (FUJIFILM Wako) with 10% FBS and 1% penicillin/streptomycin. The human immortalised mesenchymal stem cell (hiMSC)39 line was kindly provided by Dr. J. Toguchida and was cultured in Dulbecco’s modified Eagle’s medium (FUJIFILM Wako) with 10% FBS and 1% penicillin/streptomycin. HEK293 clones that contained each HAC/MAC were selected with 200 µg/mL hygromycin B (FUJIFILM Wako). HT1080 cell and hiMSC clones that contained HAC2 were selected with 8 and 4 µg/mL blasticidin S, respectively. HT1080 clones that contained MAC2 were selected with 200 µg/mL hygromycin B. For drug selection after transfection using the SIM system, HACs/MACs expressed the HPRT gene for hypoxanthine-aminopterin-thymidine (HAT) resistance following gene insertion. HEK293 and HT1080 clones were selected after transfection in HAT medium (Sigma-Aldrich). hiPSC cell line 201B7 (HPS0063) was provided by the RIKEN BRC and cultured in StemFit AK02N (Takara Bio, Kusatsu, Japan) with Laminin-511 (Nippi, Adachiku, Japan). hiPSCs that contained MAC6 with a neomycin resistance gene were selected with 90 µg/mL G418.
Microcell-mediated chromosome transfer
To prepare microcells that contained 21HAC1, MAC2, or MAC4, 1 × 107 chromosome donor CHO cells that contained each artificial chromosome were cotransfected with 12 μg pTNH6-H-αCD9 for HEK293 cells and hiPSCs or pTNH6-H for HT1080 cells and 12 μg pCAG-T7-F for each recipient cell line by Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA) in accordance with the manufacturer’s instructions26,34. CHO 4H6.1 M cells stably expressed MV-H and F, which provided microcells that contained 21HAC2 as reported previously35. Twelve flasks of CHO cells were prepared and micronuclei were induced by treatment with 0.1 µg/mL colcemid. The detailed MMCT protocol has been described previously26. The collected microcells were cocultured and fused with 2 × 106 cells of each recipient cell line for 24 h in a 6-cm dish (Corning, Corning, NY, USA). Then, the fused recipient cells were subcultured into three 10-cm dishes. Drug selection was started with optimal selectable antibiotics after a further 24 h of incubation. After 14–21 days, drug-resistant colonies were picked up and expanded for the following analyses.
Plasmid construction
To construct pBG-V0b1-ins-ELuc-ins, an EcoRV-digested fragment, which included an ELuc expression unit from CAG-ELuc, was ligated into pBG-V0b1 linearised with EcoRV. To construct pBG2-V1a-ins-tdtmt-ins and pBG2-V2a-ins-BFP-ins, each fragment of pCMV-tdTomato (Takara Bio) and pTagBFP2-N (Evrogen) was amplified by PCR with the following primers, F: 5′- GAACCTGCACTAGCCATCATGTTCTTTCCTGCGTTAT -3′, R: 5′- AAAAACGCGTGTCGATCCTGCACTAGCCATTTAAGATACATTGATGAGTT -3′. Then, each PCR product was digested with AflIII and ligated to a fragment of pinsB4ins prepared by HincII and AflII digestion. Then, fragments from pinsB4ins that contained tdTomato or TagBFP2-N were prepared by EcoRI digestion and ligated into pBG2-V1a for pBG2-V1a-ins-tdtmt-ins and pBG2-V2a for TagBFP2-N via MluI sites in each vector. To construct GLV2-EF1a-tdTomato, tDNA-pEF1a-BGHpA, a synthesised DNA, was digested by EcoRI and ligated in an annealed doubled-stranded palindrome oligo DNA, 5′- AATTCTGACTGTCTAGACAGTCA -3′, which included an XbaI site. Then, tDNA-pEF1a-BGHpA-XbaI was digested by XbaI and ligated to a fragment of pCMV-tdTomato digested by NheI and AvrII. tDNA-pEF1a-tdTomato was digested by AscI and NheI, and ligated to a PCR product amplified by PCR from pBG2-Vla using the following primers: BxbI-PhiC31_CL_F: 5′- CGCATGGCGCGCCTGGCCGTGGCCGTGCTCGTC -3′ and BxbI-PhiC31_CL_R: 5′- CTAGTCCTAGGGACCCTACGCCCCCAACTGA -3′ and by digestion with AscI and NheI. To construct GLV3-NeoR-pEF1a-BFP, tDNA-EF1a-BGHpA, a synthesised DNA was digested by EcoRI and ligated to a PCR product amplified from pTagBFP2-N by primers BFP_cl_EcoRI_F: 5′- CGAGTCGAATTCGCCACCATGGTGTCTAAGGGCGAAGAGCTGA -3′ and BFP_cl_EcoRI_R: 5′- TGTAACGAATTCCTATTAATTAAGTTTGTGCCCCAGTTTGC -3′, and digested by EcoRI. Furthermore, tDNA-EF1a-BFP was digested by AscI and NheI, and ligated to a PCR product amplified from pBG2-V2a by primers PhiC31 attB 3’HPRT Asc1 F: 5′- CGCATGGCGCGCCGATGTAGGTCACGGTCTCGAAG -3′ and PhiC31 attB 3’HPRT cl R: 5′- CTAGTCCTAGGAGGCTGGTTCTTTCCGCCT -3′, and digested by AscI and AvrII (GLV3-pEF1a-BFP). Then, GLV3-pEF1a-BFP was digested by AscI and Hind III, and ligated to three DNA fragments amplified by PCR from GLV3-BFP with primers AscI-PhiC31 attB-AvrII F: 5ʹ- GGCCGCATGGCGCGCCGATG -3′ and AscI-PhiC31 attB-AvrII R: 5ʹ- AAAACCTAGGTCATCATGATGGACCAGATG -3′, pBG2-V1b1 with primers AvrII-NeoR-AgeI F: 5′- AAAACCTAGGGCGGCCGCCGTGACCTGCAC -3′ and AvrII-NeoR-AgeI R: 5′- AAAAACCGGTCCCCAGCTGGTTCTTTCCGC -3′, and an annealed double-stranded oligomer DNA with primers AgeI-HindIII oligo F: 5′- AGCTTGATTTCGGCCTATTGA -3′ and AgeI-HindIII oligo R: 5′- CCGGTCAATAGGCCGAAATCA -3′. The mCherry expression vector with a Cre-loxP system was a modified X3.1-I-EGFP-I vector48. X3.1-I-EGFP-I that contained the Cre-loxP system was digested with NcoI and SpeI, which removed EGFP. The HS4 insulator on X3.1-I-EGFP-I was amplified with primers 5′- ATCCATGGATCGACTCTAGAGGGACAGCC -3′ and 5′- ATAACTAGTCGACGCGGCCGCCTCACTGACTCCGTCCTGGA -3′, and ligated using NcoI and SpeI sites. mCherry expression vectors with three types of constitutive promoters (PGK, EF1α, and CAG) were purchased from VectorBuilder (Chicago, IL, USA). The vector information is available from the database of VectorBuilder with the following vector IDs: pRP-[Exp]-hPGK > mCherry), pRP-[Exp]-EF1A > mCherry, and pRP-[Exp]-CAG > mCherry. These mCherry expression cassettes were prepared by NotI digestion of the mCherry expression vector. Then, each mCherry expression cassette was inserted into the modified X3.1 without EGFP.
Transfection and gene loading into each HAC/MAC by Cre-loxP and SIM systems
HEK293 and HT1080 cells that contained HACs/MACs were prepared at 5 × 106 cells per 10-cm dish. HEK293 and HT1080 cells were transfected using a previously described method25. Transfected plasmids were 3.5 µg pBG2-V0b-ins-ELuc-ins, 7 µg pBG2-V1a-ins-tdTomato-ins, 10.5 µg pBG2-V2a-ins-BFP-ins, 3 µg pBS185 (pCMV-Cre), 3 µg pCMV-Bxb1 integrase, and 3 µg pCMV-PhiC31 integrase. These plasmids were mixed and transfected with Lipofectamine 2000 (Invitrogen), following the manufacturer’s instructions. Then, the transfected cells were selected in 2% HAT medium. hiPSCs that contained HACs/MACs were prepared at 2 × 106 cells per 10-cm dish. The introduced plasmids were 3.5 µg pBG2-V0b1-ins-ELuc-ins, 7 µg GLV2-tdTomato, 10.5 µg GLV3-NeoR-BFP, 3 µg pEF1a-Cre, 3 µg pCAG-Bxb1 integrase, and 3 µg pCAG-PhiC31 integrase. The mixture of plasmids was introduced into hiPSCs by a NEPA21 electroporator (NEPAGENE, Ichikawa, Japan) with the following conditions: pouring pulse, 135 or 175 V; pulse length, 2.5 milliseconds; pulse interval 50 ms; number of pulses, 2; decay rate, 10% and polarity + , and then transfer pulse, 20 V; pulse length, 50 milliseconds; pulse interval, 50 milliseconds, number of pulses, 2, decay rate, 40% and polarity, + /−. Then, the electroporated cells were expanded in the 10-cm dish and 90 µg/mL G418 was added to the culture medium at 48 h after electroporation. We also used another method of electroporation by a Nucleofector 4D (Lonza, Basel, Switzerland). The introduced plasmids were 3.5 µg pBG2-V0b-ins-ELuc-ins, 7 µg GLV2-tdTomato, 10.5 µg GLV3-NeoR-BFP, 3 µg pEF1a-Cre, 3 µg pEF1a-Bxb1 integrase, and 3 µg pEF1a-PhiC31 integrase. A total of 1 × 106 hiPSCs and plasmids were mixed with P3 Primary Cell 4D-Nucleofector™ X Kit L (Lonza), following the manufacturer’s instructions, and pulsed with the CA-137 program. Eight micrograms of X3.1 that contained mCherry with each constitutive promoter and 2 µg of a Cre expression vector (pBS185) were mixed and introduced into hiMSCs by the NEPA21 electroporator with the following conditions: pouring pulse, 175 V; pulse length, 2.5 millisconds; pulse interval, 50 milliseconds; the number of pulses, 2; decay rate, 10% and polarity + , and then transfer pulse, 20 V; pulse length, 50 milliseconds, pulse interval, 50 milliseconds, number of pulses, 2; decay rate 40% and polarity + /−. Then, hiMSCs were selected in 2% HAT medium. pBS185 CMV-Cre was a gift from Brian Sauer (Addgene plasmid # 11,916; http://n2t.net/addgene:11916; RRID: Addgene_11916)49.
Gene knockout by CRISPR/Cas9
Gene knockout of HPRT1 was performed in HEK293 cells, hiMSCs, and hiPSCs with the multiplex CRISPR/FokI-dCas9 vector system50,51. The multiplex CRISPR/FokI-dCas9 vector system targeted six sequences for knockout of the HPRT1 gene: HPRT T1: 5′- TAACGGAGCCGGCCGGCGCGCGG -3′, HPRT T2: 5′- TGGCGTCGTGGTGAGCAGCTCGG -3′, HPRT T3: 5′- AAATCCTCAGCATAATGATTAGG -3′, HPRT T4: 5′- CTCATGGACTAATTATGGACAGG -3′, HPRT T5: 5′- CACAGAGGGCTACAATGTGATGG -3′ and HPRT T6: 5′- TAAATTCTTTGCTGACCTGCTGG -3′. The vector system was transfected into HEK293 cells and then HPRT knockout cells were screened by 100 µM 6TG treatment. HT1080 clones with spontaneous mutation of the HPRT1 gene were selected by 6TG treatment. Gene knockout of the neomycin resistance gene was performed with CRISPR/Cas9 targeting 5ʹ- AGGCTATTCGGCTATGACTGGG -3′27.
PCR analysis
PCR analyses were performed with KOD Fx (TOYOBO, Osaka, Japan), following the manufacturer’s instructions. The primers to detect gene insertion in HACs/MACs via the SIM system were HPRT junc sp F 5′- CGGCTTCCTCCTCCTGAACAA -3′ and HPRT junc sp R 5ʹ- TCCATAAGACAGAATGCTATGCAACC -3′ for HPRT EX1-2 and HPRT EX3-9 reconstitution in HEK293, HT1080 and hiMSCs, and TRANS L1 5ʹ- TGGAGGCCATAAACAAGAAGAC -3ʹ and SIM Neo Rv 5ʹ- CGCCTTGAGCCTGGCGAACA -3′ for HPRT EX1-2 and Neo cDNA reconstitution in human iPSCs.
FISH analysis
Cells were treated with colcemid to induce metaphase arrest, treated with 0.075 M KCl, and then fixed with methanol/acetate (3:1) (FUJIFILM Wako). FISH was performed with the p11-4 alpha satellite probe52 to stain the alpha satellite of hChr.13, 21 and HAC, and mouse Cot-1 DNA to stain the MAC. The probes were labelled with digoxigenin (Roche, Basel, Schweiz) and the inserted plasmid vector targeted to the chromosome fragment was labelled with biotin (Roche). The DNA probes were labelled with a nick translation kit (Roche), following the manufacturer’s instructions. The detailed protocol has been described previously26.
Teratoma formation and histological analysis
Mice were maintained under specific pathogen-free conditions with a 12-h light–dark cycle. Human iPSCs (1 × 106) were subcutaneously transplanted into a testis of anaesthetised severe combined immunodeficiency mice (Charles River, Yokohama, Japan). A mixed anaesthetic agent prepared with 0.3 mg/kg medetomidine hydrochloride, 4 mg/kg midazolam, and 5 mg/kg butorphanol tartrate was administered intraperitoneally to the mice. Teratomas appeared after ~ 8 weeks. The anaesthetised mice were sacrificed and the teratomas were collected. Then, the teratomas were fixed with 20% neutral formalin/PBS and processed for paraffin sectioning. The sections were stained with haematoxylin and eosin.
FCM analysis
To evaluate the ratio of cells that expressed fluorescent proteins, the cells were analysed by FCM using a BD LSRFortessa X-20 flow cytometer (Beckton Dickinson) equipped with 488, 405, and 561 nm lasers to detect EGFP, BFP2, and tdTomato, respectively. The ratio of fluorescence-positive cells of each fluorescent protein was determined by measuring 10,000 cells in each experiment.
Luciferase assay
The assay was performed with 6 × 104 cells in each well of a 96-well plate. Luciferase activity was measured with Emerald Luc Luciferase Assay Reagent Neo (TOYOBO), following the manufacturer’s instructions. Bioluminescence was measured for 1 s by an EnVision (PerkinElmer, Waltham, MA, USA)26.
RT-PCR
Total RNA was isolated with a Nucleospin RNA plus kit (Takara Bio), following the manufacturer’s instructions. cDNA was synthesised with a PrimeScript™ II 1st strand cDNA Synthesis Kit (Takara Bio), following the manufacturer’s instructions. RT-PCR analyses were performed with KOD one, cDNA, and the following primer sets: CXCL1 F 5′- TGTGAAGGCAGGGGAATGTA -3′ and R 5′- GCCCCTTTGTTCTAAGCCAG -3′, CD90 F 5′- ATGAACCTGGCCATCAGCA -3′ and R 5′- GTGTGCTCAGGCACCCC -3′, IL-8 F 5′- ACCGGAAGGAACCATCTCAC -3ʹ and R 5′- ATTTGGGGTGGAAAGGTTTG -3′, and CCL2 F 5′- GCAGCAAGTGTCCCAAAGAA -3′ and R 5′- AACAGGGTGTCTGGGGAAAG -3ʹ.
Quantitative RT-PCR
qRT-PCR analysis was performed with TB Green® Fast qPCR Mix (Takara Bio), following the manufacturer’s instructions. The following primer sets were used: mCherry F 5′- AAGGGCGAGGAGGATAACAT -3′ and R 5′- ACATGAACTGAGGGGACAGG -3′, GAPDH1F 5′- AGCCACATCGCTCAGACAC -3′, R 5ʹ- GCCCAATACGACCAAATCC -3′. OCT 3/4 F 5′- AGAAGGATGTGGTCCGAGTGTG -3′, R 5′- CCACCCTTTGTGTTCCCAATTCC -3′. The enzyme reactions and measurements were performed with the Applied Biosystems 7300 Fast Real-Time PCR System (Thermo Fisher Scientific), following the manufacturer’s instructions. Fold changes in the gene expression level of mCherry were calculated using the ∆∆Ct method and normalised to GAPDH gene expression.
Immunofluorescence staining
iPS cells were fixed with 4% paraformaldehyde/PBS (Sigma Aldrich) in a freezer overnight. The samples were blocked with PBS that contained 5% dry skim milk and 0.1% NP-40 (FUJIFILM Wako) for 15 min at RT. Then, the samples were stained for 1 h at RT with mouse IgG2b against OCT3/4 (1:50) (Santa Cruz Biotechnology, sc-5279, Dallas, TX, USA) as the primary antibody and then anti-mouse IgG2b-Alexa 555 (1:500) (Thermo Fisher Scientific, A-21147) for detection. Image were obtained under a Keyence BZ-X800 (Keyence, Osaka, Japan).
Alkaline phosphatase staining
The iPS cells were prepared in confluently and fixed with 4% paraformaldehyde/PBS (Sigma Aldrich) in a freezer overnight. The staining was performed with Alkaline Phosphatase Staining Kit (Cosmo Bio Co., LTD., Tokyo, Japan). The image were obtained by microscopy for cell culture (OLYMPUS CORPORATION, Tokyo, Japan) and the attached CCD camera DP22 and Software.
