Human skin samples
All experiments were performed according to the Declaration of Helsinki Principles and after permission by the Ethics Commission of the Canton Zurich (BASEC No. PB_2020_00066 and BASEC Request-No. 2018-00269). Parents or/and patients gave their informed consent. Human foreskin samples were obtained from patients aged between 1 and 15 years and were used for the isolation of keratinocytes and fibroblasts. Human neonatal back skin biopsies were taken from 1 day old donor. Human fetal back skin biopsies were harvested at 24 weeks of gestation and were used for the isolation of fibroblasts. For histological analysis, tissue samples were embedded in OCT (Sakura Finetek, Switzerland) and kept at − 20 °C.
Isolation and culturing of primary cells
Human fetal fibroblasts were extracted from fetal skin samples, as described previously in37. Human postnatal dermal fibroblasts and keratinocytes were isolated and expanded from foreskin samples, as described previously21,38. Briefly, skin samples were cut into small pieces and digested overnight at 4 °C in 12 U ml−1 dispase (BD Biosciences, Allschwil, Switzerland) in Hank’s balanced salt solution containing 5 μg ml−1 gentamycin (all from Invitrogen, Basel, Switzerland). Subsequently, epidermis was mechanically separated from dermis using forceps. Epidermis was used for the isolation of keratinocytes while dermis for extraction of fibroblasts. For keratinocytes isolation, epidermal pieces were further digested in 0.5% Trypsin–EDTA (Thermo Fisher Scientific, Basel, Switzerland) at 37 °C for 3 min. Keratinocytes were cultivated in serum free keratinocyte medium (CnT-57, CellnTec, Bern, Switzerland) containing 5 μg/ml gentamycin (Thermo Fisher Scientific, Basel, Switzerland). For fibroblasts isolation, dermis was digested in 2 mg ml−1 collagenase blend F (Sigma, Buchs, Switzerland) at 37 °C for ∼ 60 min. Dermal fibroblasts were grown in DMEM supplemented with 10% fetal calf serum (FCS), 4 mM l-alanyl-l-glutamine, 1 mM sodium pyruvate, and 5 μg ml−1 gentamycin (all from Thermo Fisher Scientific, Basel, Switzerland).
Flow cytometry analysis and sorting
Human fibroblasts isolated from fetal skin as well as from neonatal and foreskin samples at different ages were expanded in vitro until passage 1–2. Subsequently, cells were harvested from tissue culture plates using 0.5% Trypsin–EDTA (Thermo Fisher Scientific, Basel, Switzerland). Cell suspensions were stained with CD26-PE antibody (clone M-A261, 1:20, BD Biosciences, Allschwil, Switzerland) and CD90-FITC antibody (clone 5E10, 1:20, Biolegend, Amsterdam, Netherlands) according to manufacturer instructions. Stained cells were either analyzed using BD LSRFortessa flow cytometer (BD Biosciences, Allschwil, Switzerland) or sorted into 2 different groups using BD FACSAriaTM III cell sorter (BD Biosciences, Allschwil, Switzerland): CD26+ and CD26− fibroblasts. Both BD LSRFortessa flow cytometer and BD FACSAriaTM III cell sorter were provided by Flow Cytometry Facility at the University of Zurich. For each age, cells were analyzed from 3 independent biological donors.
Cytospin
Following FACS, separated CD26+ and CD26− fibroblasts were incubated for 20 min in suspension with CD26-PE antibody (clone M-A261, 1:20, BD Biosciences, Allschwil, Switzerland). Subsequently, cell suspensions were washed in DBPS, fixed in 4% paraformaldehyde, resuspended in DPBS, and cytocentrifuged using cytofunnels (Thermo Fisher Scientific, Basel, Switzerland) attached to glass slides. Stained cells were visualized using a Nikon Eclipse TE2000-U inverted fluorescent microscope (Nikon, Tokio, Japan).
Enzyme linked immunosorbent assay (ELISA)
Human/Mouse TGFβ1 ELISA Ready-SET-Go (2nd generation) kit (eBioscience, Vienna, Austria) was used according to manufacturer’s instructions to measure the concentrations of TGFβ1 in the conditioned media of CD26+ and CD26− fibroblasts isolated from foreskin samples. Briefly, CD26+ and CD26− fibroblasts were cultured in standard fibroblast medium supplemented with 10% FCS, HEPES and penicillin/streptomycin at 70% confluence. Conditioned media of CD26+ and CD26– fibroblasts were collected after 72 h of incubation, centrifuged at 300×g for 5 min, and filtered through a 0.22-μm syringe filter. To activate the latent TGFβ1 to immuno-reactive form, samples were treated with 1 N HCl and thereafter neutralized with 1 N NaOH. TGFβ1 capture antibody was used to coat Corning Costar 9018 ELISA plate (100 µl of antibody/well). The plate was incubated with antibody overnight at 4 °C. On the following day, solution was aspirated, and the wells were washed three times with 250 µl of washing buffer. Subsequently, the wells were blocked with 200 µl of 1 × ELISA/ELISPOT for 1 h at room temperature. 100 µl of standard or samples were added to appropriate wells, incubated overnight at 4 °C and washed three times with 250 µl of washing buffer on the next day. Avidin-HRP was added to the respective wells and incubated for 30 min at room temperature. Wells were then washed 5 times, and treated with 1 × TMB Solution (100 µl/well) for 15 min at room temperature. To stop the reaction, the stop solution was added into each well (50 µl/well) and the plates were analyzed at 450 nm using a spectrophotometer. To determine the baseline concentrations of TGFβ1, culture media were used. All experiments were run in triplicate using conditioned media from three independent biological donors.
Western blotting
Human CD26+ and CD26– fibroblasts were cultivated in vitro until they reached 80% confluency. Subsequently, cells were lysed in RIPA buffer containing protease inhibitor cocktail (BioRad, Cressier, Switzerland) for 5 min on ice. Cell scrapers were used to collect the lysates, and solutions were centrifuged at 14,000×g for 15 min at 4 °C. Samples were mixed with Laemmli Buffer and loaded to the wells of pre-casted gels (BioRad, Cressier, Switzerland). Electrophoresis was run in 1 × Running Buffer (BioRad, Cressier, Switzerland) for about 35 min. Thereafter, proteins were transferred from the gel to the nitrocellulose membrane using Trans-Blot Turbo transfer system (BioRad, Cressier, Switzerland). Immediately after protein transfer, the membrane was incubated with blocking solution containing 5% BSA in TBST for 60 min at room temperature on a shaker. The αSMA (clone 1A4, 1:100, Baar, Switzerland) primary antibody was added to the membrane and incubated overnight at 4 °C on a shaker. On the next day, the membrane was washed five times in 1 × TBST at room temperature. The membrane was incubated with horseradish peroxidase (HRP)-labeled anti-mouse secondary antibody for 1 h at room temperature. Subsequently, the membrane was again washed extensively with 1 × TBST and incubated with substrate solution (BioRad, Cressier, Switzerland) for 3–5 min. The results were visualized using Syngene G-Box (Syngene, United Kingdom).
CD26 knockout using lenti-CRISPR/Cas9 viral vectors
A lentiviral gene transfer system was applied to inhibit the expression of CD26 in human primary skin fibroblasts. The 20-nucleotide gRNA sequence (GTTGTGAGCTGAATCCGGAA) was obtained from http://crispr.mit.edu/. A lentivirus CRISPR vector for Cas9 and the gRNA co-expression was designed in VectorBuilder (VectorBuilder Inc., Chicago, IL). The plasmid sequence is shown in the Supporting Information.
Lentiviral vectors were produced by transient transfection of HEK293FT cells. The cells were co-transfected with the transfer vector and VSVG, REV, and MDL plasmids using the calcium phosphate method at a plasmid molar ratio 1:1:1:1. A total of 1 × 106 cells were seeded in 25 cm2 tissue culture flasks 24 h before transfection. Cells were refed with fresh complete medium 2 h before transfection. The final transfection mixture had a total DNA amount of 10 µg and a CaCl2 concentration of 125 mM. Fresh complete medium (4 ml) was added to the cells 20 h post-transfection. Twenty-four hours later, the viral supernatant was collected, filtered through a 0.45 µm syringe filter and concentrated to a final volume of 0.05 mL (approximately 80-fold) using Amicon® Ultra Centrifugal Filter Units 100 KDa (Merck Millipore, Darmstadt, Germany). The aliquots were stored at − 80 °C.
Human primary skin fibroblasts were grown to 80% confluency in 24-well plates and transduced with 10 µl lentiviral concentrate complexed with 5 µg Polybrene (Sigma-Aldrich) in 0.5 ml complete medium. The next day, the cells were washed, and fresh medium was added.
At 48 h post-infection, knockout cells were selected with blasticidin. The CD26 knockout was confirmed by immunostaining on live cells with the antibody (clone M-A261, 1:20, BD Biosciences (Allschwil, Switzerland) followed by flow cytometry analysis using a FACSAriaIII equipped with the FACSDiva® Software (BD Biosciences, Allschwil, Switzerland).
Preparation of dermo-epidermal skin analogs
To prepare dermo-epidermal skin substitutes, 1 × 105 of stromal cells (CD26+ or CD26knockout) were mixed with collagen type I (Symatese, France) and casted into 6-well cell culture inserts (3.0 µm pore-size membranes) (BD Falcon, Switzerland). These dermal compartments were cultivated in vitro for additional 7 days in DMEM medium supplemented with 10% fetal calf serum (Invitrogen, Switzerland), 5% Pen/Strep, 5% HEPES. Thereafter, 8 × 105 of keratinocytes from interfollicular epidermis were seeded onto the dermal equivalents. Dermo-epidermal skin substitutes were cultivated in vitro for additional 5 days and subsequently they were transplanted onto back of immune-incompetent rats.
Transplantation of cultured skin substitutes
The experimental procedures were approved by the Local Committee for Experimental Animal Research (Cantonal Veterinary Office Zurich, permission number: ZH090/2015) and performed in accordance with relevant guidelines and regulations. We confirm that the study was reported in accordance with ARRIVE guidelines. Eight to ten weeks old female Nu/Nu rats (Charles River, Freiburg, Germany) were anesthetized by inhalation of 5% Isofluran (Baxter, Volketswil, Switzerland), and maintained by inhalation of 2.5% Isofluran via mask as described previously in39,40. The dermo-epidermal skin substitutes were transplanted on full-thickness skin wounds created on the back of the rats. Custom made surgical steel rings (diameter 2.6 cm) were sutured to the skin of rats, to prevent from wound closure. As a wound dressing, Silicon foil (Silon-SES, BMS, USA), a polyurethane sponge (Ligasano, Ligamed, Austria) and tape (Leukoplast, BSN medical, Germany) were applied. Dressing changes were made once per week. The animals were euthanized by CO2 three weeks after transplantation and skin grafts were excised and embedded in OCT compound for further analysis.
Immunohistochemical staining and analysis
10–12 µm cryosections or cells on cell culture dishes were fixed in acetone/methanol 1:1 mixture for 5 min at − 20 °C. Subsequently, slides or plates were blocked with 2% Bovine Serum Albumin in PBS and incubated with primary antibodies either overnight at 4 °C or 1 h at room temperature. On the following day, slides or plates were washed 3 times in PBS and incubated with corresponding FITC or TRITC-conjugated secondary antibodies for 45 min at room temperature. To stain cell nuclei, 4′,6-Diamidin-2-phenylindol (DAPI) was used. Finally, after additional washing in PBS, slides were mounted in mounting medium (Sigma-Aldrich, Buchs, Switzerland) and cover-slipped. To take pictures of immunofluorescence stainings, a Nikon Eclipse TE2000-U inverted microscope equipped with Hoechst, FITC and TRITC filter sets (Nikon AG, Egg, Switzerland; Software: Nikon ACT-1 vers. 2.70) was used. The images were taken by a connected digital camera (DXM1200F) and were further processed with Photoshop 11.0.
For immunofluorescence analysis the following antibodies were used: CD26-PE (clone M-A261, 1:20) from BD Biosciences (Allschwil, Switzerland); CD90-FITC (clone 5E10, 1:20) from Biolegend (Amsterdam, Netherlands); Ki67 (clone B56, 1:200), CD31 (clone TLD-3A12, 1:100) all form BD Pharmingen (Basel, Switzerland); fibronectin (polyclonal, 1:100) from Abcam (Germany); αSMA (clone 1A4, 1:100), CK19 (clone RCK108, 1:50), CK10 (clone DE-K10, 1:100) all from Dako (Baar, Switzerland); CD90 (clone AS02, 1:100) from Merck Millipore (Darmstadt, Germany); TGFβ1 (clone 9016, 1:100) from R&D Systems (Germany); CK15 (clone SP190, 1:100) from Santa Cruz (Heidelberg, Germany); CK1 (clone LHK1, 1:200) from Progen (Heidelberg, Germany); Laminin-5 (clone P3H9-2, 1:100) from Labforce (Nunningen, Switzerland); CK16 (clone LL025, 1:50) from Invitrogen (Basel, Switzerland).
Quantification of the area of TGFβ1, αSMA, fibronectin and collagen immunofluorescence staining
For each sample, five sections (20 × magnifications) were capture to quantify the area of TGFβ1, αSMA, fibronectin and collagen immunofluorescence signals (n = 5 per condition; from 3 independent donors/experiments). The positively stained area was measured using the same macroscopic settings and quantified using NIH ImageJ software. The positively stained area was normalized to the number of cells. P value was calculated using unpaired student t-test.
Quantification of the area of CK10 and CK16 immunofluorescence staining
For each sample, five sections (20 × magnifications) were captured to quantify the area of CK10 and CK16 immunofluorescence signals (n = 5 per condition; from 3 independent donors/experiments). From each picture, the region of interest was chosen. The positively stained area was measured in the region of interest and is presented as percentage of total area of region of interests. The quantification was performed using NIH ImageJ software. All pictures were taken using the same macroscopic settings.
Quantification of Ki67+ cells in the epidermal and dermal compartments of transplanted skin grafts
Transplanted skin grafts were stained for Ki67. In order to examine the proliferation of fibroblasts, the specific regions of interest was chosen in the dermal compartments of transplanted skin grafts. Ki67+ fibroblasts were calculated in the regions of interest and results are presented as the number of proliferating Ki67+ fibroblasts per 1 cm2 of dermis. In order to examine proliferating keratinocytes, Ki67+ cells located on the epidermal basal cell layer were quantify. Results are presented as the number of proliferating Ki67+ keratinocytes per 1 mm of basal cell layer. To verify the proliferation of keratinocytes in the epidermal suprabasal cell layers, the respective regions of interest were chosen. The Ki67+ cells were quantified in the regions of interest. The results are presented as the number of Ki67+, proliferating keratinocytes per 1 cm2 of epidermis. Five different regions of interest were chosen for each group (n = 5).
Quantification of the density of cells in the dermal compartments of transplanted skin grafts
In order to quantify the total density of fibroblasts in transplanted skin grafts, the regions of interest were chosen in the dermal compartments. The total number nuclei (stained with DAPI) was quantified using NIH ImageJ software. Results are presented as the number of cells per 1 cm2 of dermis. Five different regions of interest were chosen for each group (n = 5).
Statistical analysis
All results are reported as mean ± standard deviation (SD). GraphPad Prism 4.0 (Graph Pad software, La Jolla, CA, USA) was used to perform the statistical analysis. The unpaired Student’s t-test was used to perform the comparison between two groups. Results were considered significant according to GraphPad Prism: *indicates p-value 0.01 to 0.05 (significant), **Indicates p-value 0.001 to 0.01 (very significant), ***Indicates p < 0.001 (extremely significant), ns = not significant (p > 0.05).
