Expression plasmid and viral vector generation
Plasmids expressing EGFP transcribed from the MLP were constructed. Ad5 wildtype-MLP, MLP-TetO1a, MLP-TetO1b or MLP-TetO2 sequences were synthesised in a pUC57 plasmid backbone (Genewiz, NJ, USA) and used as a template for PCR with forward primer 5′-GAACATTTCTCTGTCGACCAACTAGTCGCCCTCTTCGGCATCAAG-3′ and reverse 5′-GGCCCTCGCAGACAGCGATGCGGAAGAGAG-3′, to generate DNA fragments with flanking homology sequences corresponding to the SalI restriction site position of plasmid OG186 pSF-pA-PromMCS (OXGENE, Oxford, UK) and the first-leader sequence of the adenovirus tripartite leader (TPL) (accession no: AY339865). A second DNA fragment encoding the EGFP reporter fused to the Ad5 TPL I-II-III was extracted by PCR from plasmid pSU109 using forward primer 5′-TCTCTTCCGCATCGCTGTCTGCGAGGGCC-3′ and reverse 5′-AGCTGAAGGTACGCTGTATC-3′. MLP-TetO PCR fragments were cloned into a SalI and NheI linearised OG186 with the Ad-TPL-EGFP fragment by Gibson DNA assembly (New England Biolabs, MA, USA) to generate plasmids pMLPwt-EGFP, pMLP-TetO1a-EGFP, pMLP-TetO1b-EGFP, or pMLP-TetO2-EGFP. Plasmid OG268 containing a E1/E3-deleted Ad5 genome (OXGENE, Oxford, UK) was engineered to encode MLP-TetO1a, MLP-TetO1b, MLP-TetO2 sequences as follows. DNA sequences encoding the wildtype Ad5 MLP were extracted from plasmid OG617 (OXGENE, Oxford, UK), harbouring the full-length genome of wildtype Ad5, by PCR using forward primer 5′-CACTGACTGACTGATACAATCGATGAAGAAAACGGTTTCCG-3′ and reverse 5′-CTGCGGATCCAGAAATCGATATCGATGCCGAAGGGGGCGTGGTC-3′ and cloned into ClaI linearised plasmid OG10 (OXGENE, Oxford, UK) Gibson DNA assembly (New England Biolabs, MA, USA) to create P4481. P4481 was further modified to add extended DNA sequences mapping to the E2B region of Ad5. E2B sequence was extracted by PCR using forward primer 5′-GCGCAGTACTGGCAGCGGTGCACGGGCTGTACATCCTGCACGAG-3′ and reverse 5′-CGCTGTATCTCAGTCAGTCAAGCTAGCGCAGCAGCCGCCGCGCC-3′ from OG268 and cloned into BsrGI and NheI linearised P4481 to create pSU43. DNA fragments corresponding to MLP-TetO1a, MLP-TetO1b, or MLP-TetO2 promoters were extracted from pUC57 plasmid backbone with PcII and DraIII and cloned into pSU43 linearised with the same enzyme to generate the MLP-TetO1a, MLP-TetO1b, and MLP-TetO2 shuttle plasmids. Sequence fragments encompassing Ad5 E2B with MLP-TetO1a, MLP-TetO1b, or MLP-TetO2 were extracted from the MLP shuttle plasmids using SphI and NheI and cloned into Bstz17I and XbaI linearised OG268 by Gibson DNA assembly (New England Biolabs, MA, USA) for exchange of the WT-MLP to create pSU208 (Ad5-MLP-TetO1a), pSU196 (Ad5-MLP-TetO1b), and pSU233 (Ad5-MLP-TetO2). For the construction of Ad5-MLP-TetO1b-SA-TetR (TESSA, pSU390) plasmid pSU196 was modified to insert a TetR coding sequence into the E3-deleted region. pSU79, an Ad5 E3-deleted-region shuttle plasmid was modified to insert a small multiple-cloning-site (MCS) by oligonucleotide annealing with forward primer 5′-CTTAAAATCAGTTAGCAAATTTATGCATGTCGACTACGCCTCGAGGAGTAATCATTACGGGGTC-3′ and reverse 5′-TATTAGTTAAAGGGAATAAGATCGCGACCTAG GATAGCCGTCGACGGTCACCTGAGGTGACGACTACCACATTTGTAGAG-3′ and cloned into pSU79 plasmid linearised with SalI to create pSU149. DNA fragments coding for the TetR was amplified by PCR using forward primer 5′-CTTAAAATCAGTTAGCAAATTTATGCATGCAGGAGGAGGTACCCACCATGTCGCGCCTGGACAAAAG-3′ and reverse 5′-GAATAAGATCGCGACCTAGGATAGCCGTCGACCTTTAAAAAACCTCCCACAC-3′ from template plasmid OG4156 (OXGENE, Oxford, UK) and cloned into pSU149 linearised with SalI enzyme to create pSU375. DNA fragments encoding TetR with flanking adenovirus DNA were extracted from pSU375 with enzymes SpeI and AscI and cloned into pSU196 linearised with the same enzymes to generate pSU382. Subsequently, DNA fragments corresponding to the L4 region of Ad5 were extracted from plasmid OG268 and ligated into NdeI linearised pSU382 to generate Ad5-MLP-TetO1b-SA-TetR (TESSA, pSU390). pSU390 or OG268 was further modified to insert the recombinant AAV2 genome, with a CMV-EGFP expression cassette, into the E1-deleted region. AAV2-CMV-EGFP fragment was excised from plasmid P3322 (OXGENE, Oxford, UK) using enzymes AsiSI and PacI and ligated into PacI linearised pSU390 and OG268 plasmid to generate plasmid pSU468 (TESSA-AAV) or pSU467 (Ad5-AAV), respectively. pAAV-CMV plasmid (Clontech, CA, USA) was modified to encode an EGFP coding sequence in the MCS to generate the pAAV-CMV-EGFP. For the construction of plasmid encoding the AAV transfer vector pscAAV-hFIX, DNA sequences corresponding to nucleotide 1 to 2362 of scAAV LP1-hFIXco38 were synthesised as two gene fragments into pUC57 plasmids (Genewiz, NJ, USA). DNA fragments corresponding to the left and right section of LP1-hFIXco were extracted from the pUC57 plasmids using restriction enzymes AFlIII with XbaI, and BpuEI with PacI, respectively, and assembled into plasmid OG10 (OXGENE, Oxford, UK) linearised with AsiSI and SbfI using Gibson Assembly (New England Biolabs, MA, USA) to generate pSU878. For the construction of AAV transfer plasmid pAAV-hFIX, DNA fragment corresponding to the right AAV-ITR was extracted from pAAV-CMV-EGFP using MfeI and PacI and inserted into pSU878 digested with same restriction enzymes to generate pSU907. For the construction of TESSA-RepCap2, a 2.3Kb DNA fragment corresponding to AAV2 Rep78/68, wherein the p19 promoter and p40 inhibitory sequence was scrambled by synonymous codon exchange, was extracted from Ad5-E1-shuttle plasmid pSU633 using PacI restriction enzyme and inserted into pSU390 linearized with PacI to generate TESSA-Rep78/68 (pSU1091). Subsequently, a DNA fragment from Ad5-E1-deleted shuttle plasmid (pSU622) encoding the AAV Cap2 nucleotide sequence 1693 to 4220 from pRepCap2 (accession: AF369963.1), fused to the +1 transcriptional start site of the CMV promoter, was extracted by PacI restriction digest and inserted into AsiSI linearised pSU1091 to generate pSU1209 (TESSA-RepCap2). For construction of TESSA-RepCap5, TESSA-RepCap6 and TESSA-RepCap8, plasmid (pSU1114) encoding AAV5 Cap encoding AAV5 Cap corresponding to nucleotide sequence 2210 to 4382 of the AAV5 genome (accession: AF085716.1), plasmid (R1149) encoding AAV6 Cap corresponding to nucleotide sequence 2210 to 4382 of the AAV6 genome (accession: AF028704.1), and plasmid (R1231) encoding AAV8 Cap corresponding to nucleotide sequence 2121 to 4338 of the AAV8 genome (accession: AF513852.1) under transcription control of a minimal CMV promoter was used as a PCR template for amplification using forward primer 5′-GTTGGCGTTTTATTATTATAGTCAGCTGACGGCGATTAAAAAAAACCTCCCACACCTCCCCCTGAACC-3′ and reverse primer 5′ CCCATCGATGGCGGCCGCCCCAGCGATTAAGATCGATCTGTCGACCAACTAGTACCCCGGGAAC-3′. The amplified AAV5, -6 and -8 cap sequences were inserted into AsiSI linearised plasmid pSU1091 using Gibson Assembly (New England Biolabs, MA, USA) to generate TESSA-RepCap5 (pSU1257), RepCap6 (R1236), TESSA-RepCap8 (R1238), respectively. For the construction of TESSA-RepCap9, and plasmid (R497) encoding AAV9 Cap corresponding to nucleotide sequence 1 to 2211 of the AAV9 hu.14 capsid protein VP1 (cap) gene (accession: AY530579.1) under transcriptional control of a CMV promoter was used as a PCR template for amplification using forward primer 5′-GTTGGCGTTTTATTATTATAGTCAGCTGACGGCGATTAAAAAAAACCTCCCACACCTCCCCCTGAACC-3′ and reverse primer 5′-GGTTTTTTTTAATTAACCCATCGATGGCGGCCGCCCCAGCGATTAAGATCTAGTAATCAATTACGGGGTCATTAG-3′. The amplified AAV9 cap sequences were inserted into AsiSI linearised plasmid pSU1091 using Gibson Assembly (New England Biolabs, MA, USA) to generate TESSA-RepCap9 (pSU1249).
Cell culture
HEK293 cells (293AD, Cell Biolabs, CA, USA) and Flp-In T-REx 293 cells (ThermoFisher Scientific, MA, USA) were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Sigma-Aldrich, MO, USA) supplemented with 10% (v/v) heat-inactivated foetal bovine serum (FBS; Gibco, MA, USA) and maintained at 5% CO2, 37 °C, and 95% humidity. U-87 MG (ATCC, VA, USA) and HeLa RC32 (ATCC, VA, USA) were cultured in DMEM supplemented with 10% (v/v) heat-inactivated foetal bovine serum and maintained at 5% CO2, 37 °C, and 95% humidity. Suspension HEK293 cells (OXGENE, Oxford, UK) were cultured in BalanCD (Irvine Scientific, CA, USA) supplemented with 4 mM Ultraglutamine I (Lonza, Basel, Switzerland). Cultures were maintained at 125 RPM, 37 °C, 8% CO2 and 85% humidity.
Adenovirus generation and titration
All recombinant adenoviral vectors were initially recovered in HEK293 cells from plasmid DNA encoding each viral genome. Plasmids (20 μg) were linearised with SwaI restriction enzymes to release virus ITRs from the bacterial plasmid backbone and purified using a genomic Purelink DNA extraction kit (Invitrogen, CA, USA). HEK293 cells were seeded in T25 tissue culture flasks, at a density of 2 × 106 cells per flask, for 24 h before transfection. Each flask was transfected with 2.5 μg of linearised DNA using Lipofectamine 2000 (Invitrogen, CA, USA) according to the manufacturer’s protocol. Transfection media were exchanged with fresh DMEM containing 2% FBS (supplemented with doxycycline 0.5 μg/mL or DMSO) after 4 h. Recombinant viruses were harvested from growth media ~12 days post-transfection upon observation of full CPE. Adenovirus vectors were further propagated in HEK293 cells and harvested by three rounds of freeze-thaw at day 3 post-infection. Cellular debris were pelleted by centrifugation and supernatant was passed through a 0.2 μm filter. For large-scale virus amplification and purification, HEK293 cells were seeded in Corning HYPERFlask (Sigma-Aldrich, MO, USA) for 48 h so that they are ~95% confluent before infection. TESSA-AAV or Ad5-AAV viral stock was used to infect each HYPERFlask at an MOI of 3 for 3 days. For TESSA-RepCap2, -5, -6, -8 and -9, an MOI of 15 was used for inoculation of HYPERFlasks. In addition, for the production of TESSA vectors, cell cultures were supplemented with doxycycline 0.5 μg/mL. Cells were harvested upon display of full CPE and the virus was released by three rounds of freeze-thaw. Viruses were purified by CsCl gradient banding, with Benzonase 250 U/mL (Sigma-Aldrich, MO, USA) added after the first round to degrade free DNA.
TCID50 assay for determining infectious adenovirus
HEK293 cells were seeded in 96-well tissue culture plates at a density of 1 × 104 cells per well for 24 h. Eight 10-fold serial dilutions of each adenovirus stock were made in DMEM containing 2% FBS at a total volume of 1.2 mL. For quantification of TESSA-based vectors, DMEM was additionally supplemented with doxycycline 0.5 µg/mL. Ten replicates of each diluted sample (1 × 10−5 to 1 × 10−12) were added at a volume of 100 µL per well on each plate. 100 µL of DMEM containing 2% FBS were added to the final two columns as a negative control. Plates were monitored over 12 days for the presence for viral plaques under a brightfield microscope. For TESSA-AAV and Ad5-AAV encoding the EGFP reporter, expression of EGFP observed under fluorescence microscopy was used as a proxy for infected cells. For determining infectious adenovirus contaminants in rAAV preparations generated from TESSA, eight 10-fold serial dilutions (1 × 10−1 to 1 × 10−8) of the samples were made in DMEM containing 2% FBS and doxycycline 0.5 µg/mL. Ten replicates of each diluted sample were added at a volume of 100 µL per well on each plate and wells were monitored for the presence of viral plaques over 12 days. Infectious adenovirus was determined as TCID50 per mL using the KÄRBER-SPEARMAN statistical method59. For an MOI equal to one, cells were infected with 1 TCID50 unit per cell.
Plasmid transfections for EGFP expression
HEK293 cells were seeded for 24 h in 48-well tissue culture plates (6.5 × 104 cells per well) before transfection with 0.75 μg per well of plasmid DNA using Lipofectamine 2000 according to the manufacturer’s protocol. For co-transfections, plasmids pCMV-TetR and pMLP-TetO were used at a 1:1 ratio of DNA mass. Transfection mixture diluted in Opti-MEM (Gibco, MA, USA) were exchanged with DMEM containing 10% FBS, and supplemented with doxycycline 0.5 μg/mL (unless specified) or DMSO, at 4 hpt.
rAAV vector production using adenovirus and HF system
HF rAAV production was carried out according to Takara AAVpro Helper Free System (Clontech, CA, USA). Unless stated otherwise, rAAV vectors were produced in adherent HEK293 cells. HEK293 cells were seeded in 48-well tissue culture plates, at a density of 9 × 104 cells per well, for 24 h prior to production. For production via the HF method, each well was transfected with 0.75 μg of plasmid DNA, containing pHelper, pRepCap (Cap2, -5, -6, -8 or -9) and the rAAV transfer vector (pAAV-CMV-EGFP, pAA-hFIX, or pscAAV-hFIX) diluted with Opti-MEM (Gibco, MA, USA) at a DNA mass ratio of 1:1:1, and complexed using linear PEI 25kDA (Polysciences) at a 1:3 DNA to PEI mass ratio. For rAAV production using the TESSA2.0 system, HEK293 cells were co-infected (at the indicated vector dose) with TESSA-RepCap and TESSA-AAV diluted in DMEM containing 2% FBS. For propagation of rAAV using rAAV vectors, HEK293 cells were co-infected with rAAV2 vectors at 50 GC/cell with TESSA-RepCap (Cap2, -5, -6, or -9) at the indicated vector dose and diluted in DMEM containing 2% FBS. Transfection and infection media were exchanged with fresh DMEM containing 2% FBS (supplemented with doxycycline 0.5 μg/mL or DMSO as indicated) at 6 h post-treatment. To determine the efficiency of the DNase reaction in degrading free-DNA, a HF production control was included with each experiment, wherein the stuffer plasmid pUC19 was used in place of pRepCap. Similarly, for production control using the TESSA2.0 system, HEK293 cells were only infected with TESSA-AAV. rAAV vectors were harvested via three rounds of freeze-thaw of cells suspended in growth media. Cells were pelleted by centrifugation at 3000 g for 20 min and the supernatant was harvested for vector analysis. For rAAV production in suspension HEK293 cells, 25 mL of cell suspension were seeded in non-baffled E125 Erlenmeyer shake flasks at 1.5 × 106 cells per mL for 4 h before production treatment. Cells were transfected with the HF plasmids (pHelper, pRepCap (Cap2, -5, -6, -8 or -9) and pAAV-CMV-EGFP used at a DNA mass ratio of 1:1:1) at 1 µg per mL of cell suspension and complexed using PEIpro (Polyplus-transfection, NY, USA) at a 1:2 DNA to PEI mass ratio. For rAAV production via TESSA2.0 approach, suspension HEK293 cells were infected with TESSA-AAV and TESSA-RepCap (2, 6, 8 and 9) used at an MOI of 25. rAAV vectors from suspension cell cultures were harvested at 72 hpt by addition of 10X chemical lysis buffer (10 mM Tris, 20 mM MgCl2, 1% (v/v) Triton X-100, pH 7.5) containing Benzonase (1.25 × 10−5 units per cell) and shaking at 200 RPM for 2 h 37 °C. NaCl was added to the lysate for a final concentration of 500 mM and the suspension was incubated for a further 1 h at 37 °C and shaking at 200 RPM. Cells were pelleted by centrifugation at 3000 g for 20 min and the supernatant was filtered using a 0.2 μm PES filter. For rAAV2 production from 1 L stirred-tank bioreactors (DASGIP Parallel Bioreactor Systems; Eppendorf, Hamburg, Germany), suspension HEK293 cells seeded at a 1.5 × 106 per mL were co-infected with TESSA2.0 vectors (TESSA-AAV-EGFP and TESSA-RepCap2, each at an MOI of 25) or co-infected with rAAV2-EGFP particles (HF-derived) at 50 GC/cell with TESSA-RepCap2 (used at an MOI of 25). rAAV vectors were harvested by chemical lysis, as stated previously. Supernatant was filtered using 0.2 μm PES filter and concentrated 10X by tangential flow filtration (Hollow fiber filter modules; Repligen, MA, USA). rAAV vectors produced in suspension HEK293 cells were purified by affinity chromatography using POROS™ GoPure™ AAVX affinity column (ThermoFisher Scientific, MA, USA).
Viral RNA extraction and cDNA synthesis
Total RNA was extracted using RNeasy Mini Kit (Qiagen, Venlo, Netherlands). RNA eluent (5 μL) was used for cDNA synthesis in a reverse transcription reaction (RT) using SuperScript IV First-Strand Synthesis System (Invitrogen, CA, USA). Five microlitres of each RT reaction were used as a template for qPCR to quantify viral RNA expression.
Quantification of viral genomes and gene expression using qPCR
For quantification of total adenovirus genomes in HEK293 cells, total DNA was extracted from culture media and cellular lysates using Purelink genomic DNA miniprep kit (Invitrogen, CA, USA). Five microlitres of DNA eluent were used in qPCR reactions using TaqMan Fast Advanced Master Mix (Applied Biosystems, CA, USA) in a StepOnePlus Real-Time PCR System (Applied Biosystems, CA, USA). Primer sequences for targeting Ad5 fibre are forward 5′-TGGCTGTTAAAGGCAGTTTGG-3′, reverse 5′-GCACTCCATTTTCGTCAAATCTT-3′ and probe 5′-TCCAATATCTGGAACAGTTCAAAGTGCTCATCT-3′. Primer sequences for targeting Ad5 hexon are forward 5′-CACTCATATTTCTTACATGCCCACTATT-3′, reverse 5′- GGCCTGTTGGGCATAGATTG-3′ and TaqMan probe 5′-AGGAAGGTAAC TCACGAGAACTAATGGGCCA-3′. Primer sequences for targeting TetR are forward 5′-ATGAGGTGGGAATTGAAGGAC-3′, reverse 5′-CAGCATTTCGATGGCAAGC-3′ and TaqMan probe 5′-AAGAATAAACGGGCGCTCCTAGACG-3′. Primer sequences targeting the EGFP are forward 5′-GAACCGCATCGAGCTGAA-3’, reverse 5′-TGCTTGTCGGCCATGATATAG-3′, and TaqMan probe 5′-ATCGACTTCAAGGAGGACGGCAAC-3′. Primer sequences for targeting AAV2 rep forward 5′-GGCCTCATACATCTCCTTCAAT-3′, reverse 5′- AGTCAGGCTCATAATCTTTCCC-3′ and TaqMan probe 5′- TCCAACTCGCGGTCCCAAATCAA-3′. Primer sequences for targeting AAV2 cap are forward 5′-CGACCCAAGAGACTCAACTTC-3′, reverse 5′-GAACCGTGCTGGTAAGGTTAT-3′ and TaqMan probe 5′-AAAGAGGTCACGCAGAATGACGGT-3′. Primer sequences for targeting hFIX are forward 5′-GTGTTCCCTGATGTGGACTATG-3’, reverse 5′- ACCCTGGTGAAGTCATTGAAG-3′ and TaqMan probe 5′-AGGCTGAAACCATCCTGGACAACA -3′. Primer sequences for targeting E4Orf6 are forward 5′-CACTACGACCAACACGATCT-3′, reverse 5′-GATGATCCTCCAGTATGGTAGC-3′, and TaqMan probe 5′-AGACGATCCCTACTGTACGGAGTGC-3′. Primer sequences for targeting DBP are forward 5′-GACAGCGAGGAAGAAAGAGAA-3′, reverse 5′- CTCCTTTGCCATGCTTGATTAG-3′, and TaqMan probe 5′- CGCTACAAATGGTGGGTTTCAGCA-3′. Primer sequences for targeting the AmpR are forward 5′-GCTGAATGAAGCCATACCAAAC-3′, reverse 5′-CTAGAGTAAGTAGTTCGCCAGTTAAT-3′ and TaqMan probe 5′-TGACACCACGATGCCTGTAGCAAT-3′. Primer sequences for the Ad5 packaging signal are forward 5′-CACATGTAAGCGACGGATGT-3’, reverse 5′-CTTACTCGGTTACGCCCAAAT-3′, and TaqMan probe 5′-TTGTCACTTCCTGTGTACACCGGC-3′. Primer sequences for targeting the CMV promoter are forward 5′-CATATATGGAGTTCCGCGTTACAT-3′, reverse 5′- CTATTGGCGTTACTATGGGAACATAC-3′, and TaqMan probe 5′- TGGCTGACCGCCCAACGACC-3′. PCR cycles were as follows: 95 °C 10 min; 40 times (95 °C 1 s, 60 °C 20 s).
For quantification of genome encapsulated AAV and adenovirus particles, 2 μL of viral samples harvested from cell lysates preparations were treated with 1U of TURBO DNase (ThermoFisher Scientific, MA, USA) in a 20 μL reaction for 2 h at 37 °C. TURBO DNase was heat-inactivated at 75 °C for 10 min. Five microlitres of samples diluted at 1 in 200 using nuclease-free water were used in the qPCR reaction to quantify encapsulated Ad5 using Ad5 hexon primers and probe, while EGFP or hFIX primers and probe were used to quantify encapsulated AAV genomes. Standard curves for qPCR analyses were generated using a gBLOCK gene fragment encoding the qPCR amplicon sequences, (Integrated DNA Technologies, IA, USA) and Ct values of PCR reaction used to calculate DNA copy number by extrapolation to the standard curves. Titres of total AAV vectors produced using TESSA2.0 (including TESSA2.0-AAV6, -AAV8 and -AAV9) and HF method were determined by subtraction of baseline levels from TESSA production control (HEK293 cells infected with TESSA-AAV only) and the HF production control (stuffer pUC19 transfected in place of pRepCap), respectively. rAAV productivity per cell was determined from total rAAV vectors produced by cell count at point of transfection or infection using TESSA vectors.
rAAV transduction assay
rAAV transduction was measured using a TCID50 assay in HEK293 or Hela RC32 cells. For quantification in HEK293 cells, 96-well tissue culture plates were seeded at a density of 1 × 104 cells per well for 24 h. Eight 10-fold serial dilutions of each rAAV crude lysate stock were made in DMEM containing 2% FBS at a total volume of 1.2 mL. Ten replicates of each diluted sample (1 × 10−2 to 1 × 10−10) were added at a volume of 100 µL per well on each plate. Hundred microlitres of DMEM containing 2% FBS were added to the final two columns as a negative control. Plates were observed for the presence of EGFP expressing cells from each well 6 days post-infection using a fluorescence microscope (EVOS FL imaging system, ThermoFisher Scientific, MA, USA). For quantification in Hela RC32 cells, 96-well tissue culture plates were seeded at a density of 2 × 104 cells per well for 24 h. Purified stocks of rAAV2 -6, -8 and -9 encoding EGFP produced from TESSA2.0 or HF method (Vector Biolabs, PA, USA) were quantified by EGFP-specific qPCR and normalised amounts of DNA-resistant genomes were serially diluted in DMEM containing 2% FBS and wt Ad5 (used at an MOI of 50). Eight 10-fold serial dilutions of each rAAV stock were prepared in triplicate and ten replicates of each diluted sample (1 × 10−2 to 1 × 10−10) were added at a volume of 100 µL per well on each of the triplicate plates. Plates were observed for the presence of EGFP expressing cells from each well after 48 h using a fluorescence microscope. Transducing units per mL were calculated using the KÄRBER-SPEARMAN statistical method59.
AAV cell internalisation assay
HEK293 cells were seeded in 48-well tissue culture plates at 7.5 × 104 for 24 h. Cells were counted before infection and rAAV2 derived from TESSA2.0 or HF method were used at 50 GC/cell. At 6 hpi, cells were trypsinised and extensively washed for three rounds with PBS before extraction of total DNA using a DNeasy Blood & Tissue Kits (Qiagen, Venlo, Netherlands). Viral genomes were quantified by qPCR.
Flow cytometry analysis
Cells were harvested for flow cytometry at the indicated timepoint post-transduction by trypsinisation. Flow cytometry was performed using an Attune NxT Flow Cytometer (ThermoFisher, MA, USA) or Accuri C6 flow cytometer (BD Biosciences, NJ, USA). Gating strategy for excluding dead cells and defining the EGFP negative population of HEK293 cells are shown in Supplementary Fig. 9a–c.
Western blot analysis
Detection of adenovirus capsid proteins by western blotting was carried out using Wes automated system (ProteinSimple, CA, USA) according to the manufacturer’s instructions and sample analysis carried out with Compass for SW software (ProteinSimple, CA, USA). Adenovirus was harvested from the culture medium and HEK293 cell lysate 3 days post-infection by three rounds of freeze-thaw. Cell debris was pelleted by centrifugation and lysates were probed using polyclonal antibodies directed against adenovirus type 5 (ab6982, Abcam, Cambridge, UK) and used at 1 in 50 dilution. For detection of TetR using Wes automated system, cellular extracts were harvested using RIPA buffer and probed using Anti-TetR antibody (ab25845, Abcam, Cambridge, UK) at 1 in 50 dilution. For detection of AAV2 Rep, cellular extracts were harvested from HEK293 cells using RIPA buffer. AAV capsid proteins were extracted by three rounds of freeze and thaw of the cell suspension, and the cellular debris was pelleted by centrifugation at 3000 g for 20 min. Equal amounts (25 µL) of total cellular extracts were resolved in 10% SDS-PAGE for detection AAV Rep and Cap proteins. Proteins were transferred to a nitrocellulose membrane using iBlot 2 Dry Blotting System (ThermoFisher, MA, USA) and probed with anti-AAV2 Rep antibody used at a 1 in 200 dilution (61069, clone 303.9, Progen, Heidelberg, Germany) or anti-AAV VP1/VP2/VP3 monoclonal antibody used at 1 in 200 dilution (65158, clone B1, Progen, Heidelberg, Germany). Anti-GAPDH antibody (2118, Cell Signaling Technology, MA, USA) was used at 1 in 1000 dilution. Secondary antibody donkey anti-mouse, HRP (A16011, ThermoFisher, MA, USA) was used at a 1 in 5000 dilution. Secondary antibody goat anti-rabbit, HRP (31460, ThermoFisher, MA, USA) was used at a 1 in 5000 dilution. HRP detected with TMB substrate solution (Sigma-Aldrich, MO, USA). Membranes were imaged using a Gel Doc XR + System (Bio-Rad Laboratories, UK).
AAV capsid quantification by ELISA
Quantification of assembled rAAV2, rAAV6, rAAV8 and rAAV9 capsids were carried out using AAV2 (PRAAV2R), AAV6 (PRAAV6), AAV8 (PRAAV8) and AAV8 (PRAAV9) titration ELISA kits (Progen, Heidelberg, Germany), respectively, according to the manufacturer’s instruction. Reaction plates were read using a FLUOstar Omega micoplate reader (BMG LABTECH, Ortenberg, Germany).
Transmission electron microscopy
Electron microscopy imaging of rAAV particles was carried out by the Dunn School Bioimaging Facility, University of Oxford. For TEM imaging of purified rAAV2 produced in bioreactor HEK293 suspension culture cells from the TESSA2.0 or HF transfection method, 10 µL of neat HF-derived AAV or TESSA-derived AAV diluted 1 in 5 in PBS, were further diluted 1 to 1 with water and applied to freshly glow discharged carbon formvar 300 mesh copper grids for 2 min, blotted with filter paper and stained with 2% uranyl acetate for 10 s. Grids were imaged in a FEI Tecnai 12 TEM at 120 kV using a Gatan OneView CMOS camera.
NGS analysis
TESSA-AAV was sequentially passaged in HEK293 cells and viral genomes were extracted from CsCl-purified particles. 3.7 μg of purified DNA (~1 × 1011 vector genomes) was used for sequencing by NGS Illumina HiSeq 2×250 bp run (Genewiz, NJ, USA). Sequencing reads were aligned to the reference sequence and visualized using Integrative Genomics Viewer (IGV, Broad Institute, MA, USA) and sequencing depth was determined by SAMtools depth (Genome Research Limited, UK). Burrows-Wheeler Aligner (BWA) alignment files were filtered by BCFtools (Genome Research Limited, UK) using the multi-allelic calling model, removing SNPs and indels with a Phred score of <20.
Statistical analysis
Data presented as mean ± standard error of mean (SEM), unless otherwise stated. Significance evaluated using unpaired, two-tailed Student’s t-test, unless otherwise stated, and denoted on the graphs as *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001. All statistical analysis was done using Prism 8 for Windows (GraphPad Software, USA).
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this article.
