Bacterial strains and growth conditions
L. fermentum IBL038 and L. rhamnosus IBL027 deposited in the Faculty of Biochemistry, Chemistry and Pharmacy of the National University of Tucumán (Tucumán, Argentina), were grown for 12 h at 37 °C in Man-Rogosa-Sharpe (MRS) broth (final log phase).
E. coli strains (TOP10, DH5α, DB3.1 and Rosetta) were cultured in Luria Bertani broth or on agar plates at 37 °C supplemented with 100 µg/ml ampicillin, 50 µg/ml gentamicin or 17 µg/ml chloramphenicol for plasmid selection.
PCR amplification of LysM domains
We selected two proteins of Limosilactobacillus fermentum (Basonym Lactobacillus fermentum) from the Pfam database not described before in the literature: Peptidoglycan-binding protein (Pgb) (GenBank: KPH22047.1) with one LysM domain and Mannosyl-glycoprotein endo-beta-N-acetylglucosamidase (Aclgu) (GenBank: KPH22907.1) with five LysM domains. We amplified the LysM sequences using a nested PCR as described before37 to build the Entry clones (Gateway) following the manufacturer’s instruction depicted in Fig. S1. The primers used include a fragment of the attB1 and attB2 sites for the nested PCR to build the Entry clones (Gateway) (Table 1). L. fermentum IBL038 genomic DNA was used as a template to run the PCR reaction with the Pfu polymerase using the corresponding annealing temperatures (Table 1). A second nested PCR was done to complete the attB sites as described before 37. The specific PCR products were isolated with the commercial kit High pure PCR product purification (Roche).
The LysM motifs of the N-acetylmuramidase (AcmA from L. lactis), of the gamma-D-glutamyl-meso-diaminopimelate peptidase (MurO from L. plantarum), of the extracellular surface protein (Sep from L. fermentum), of Pgb (L. fermentum) and of Acglu (L. fermentum) were aligned with the T-COFFEE program, version 11.00.d625267.
Gateway recombinant cloning of LysM domains and expression of the chimeric proteins
The Gateway cloning technology (Life Technologies) was used to introduce the sequences of interest, Pgb and Acglu, into the bacterial expression vector pETG-N-His-Venus-[rfb] according to the manufacturer’s instructions (Fig. S1). Briefly, a nested PCR was performed to amplify the desired gene as described in 4.2. Then, the reaction mix was prepared with 1 µl BP-clonase (Life technologies) containing 3 µl of the purified PCR product, and 1 µl of pDONR207, incubated at room temperature overnight and subsequently transformed by heat shock in chemically competent E. coli Top10. Plasmid DNA from individual colonies grown on LB plates supplemented with 50 μg/ml gentamicin (Life Technologies) was isolated using the High Purity Plasmid Isolation Kit (Roche) and the integrity of the pENTRY207-LysM resulting vectors was verified by enzymatic restriction with BanII (New England Biolabs) and sequenced at the CERELA-CONICET (Tucumán, Argentina) sequencing service. After this, LR recombination reactions, using the LR-clonase II enzyme mixture (Life Technologies), were performed according to the manufacturer’s instructions (Fig. S1). Briefly, the pENTRY207-LysM vectors were recombinantly cloned into the pETG-N-RGS-His-Venus- [rfB] vector. LR clonase reactions containing 1 µl of pENTRY207-LysM, 1 µl of pETG-N-RGS-His-Venus-[rfB], 2 µl of molecular grade H2O, and 1 µl of the enzyme, were incubated at room temperature overnight and subsequently transformed into chemically competent E. coli Top10. Plasmid DNA from individual colonies grown on LB plates supplemented with 100 μg/ml ampicillin (Sigma-Aldrich, Germany) was isolated as described above and the integrity of the resulting pETG-N-RGS-His-Venus-LysM vectors was verified by enzymatic restriction analysis with HindIII and XbaI and gel electrophoresis (New England Biolabs, Germany).
Finally, the E. coli Rosetta strain was transformed with the expression vectors pETG-N-RGS-His-Venus-Acglu or pETG-N-RGS-His-Venus-Pgb by heat shock and the clones were selected on plates with LB medium supplemented with 100 μg/ml ampicillin and 17 μg/ml chloramphenicol. Individual colonies were selected, and the production of the recombinant protein was evaluated. The LB broth added with antibiotics was inoculated the transformed strain. After growing to A560nm = 0.3 at 37 °C with shaking, the protein expression was induced with 2 mM IPTG, until an A560nm = 0.7–0.8 was reached. The cultures were centrifuged at 4 °C to separate the cell pellet from the supernatant. Bacterial pellets were resuspended with ice cold lysis buffer (20 mM Tris–HCl; 0.5 M NaCl; 10% glycerol and 5 mM imidazole, pH 7.9) supplemented with 0.02 mg/ml DNAse, 0.1% Triton, 0.2 mM PMSF, 1 mM DTT and 1 mg/ml lysozyme and incubated on ice for 1 h 40 min until a clear lysate was obtained. The supernatant was separated by centrifugation at 4000×g for 30 min at 4 °C and it was kept as the soluble fraction called NC (native conditions) at − 20 °C. Then, the inclusion bodies were solubilized in a buffer containing 0.5 M NaCl, 5 mM imidazole, 20 mM Tris–HCl and 8 M urea at pH 7.9 (1 ml/g pellet) and incubated on ice 90 min with stirring. Finally, it was centrifuged for 30 min at 4000×g 4 °C, and the supernatant, called DC (denaturing conditions), with the insoluble proteins, was stored at − 20 °C. Expression and purity of recombinant proteins were analyzed by SDS-PAGE followed by staining with Coomassie Brilliant Blue and checked by Western blotting using a mouse monoclonal anti-RGS-His antibody (Qiagen). Both proteins were purified using NiNTA chromatography (Thermo Fisher Scientific) and stored at − 70 °C. Protein concentrations were determined with Bradford’s reagent (BioRad) following the manufacturer’s instructions.
Preparation of BLPs, protein binding to BLPs and fluorescence microscopy
BLPs from L. rhamnosus IBL027 (BLPs027), an immunomodulatory strain, were prepared as described elsewhere11.
The purified recombinant Venus-Pgb or Venus-Acglu, or the crude extracts were incubated with BLPs (2.5 × 109 BLP/ml) under gentle rotation for 1 h at room temperature. To remove unbound proteins, the particles were washed with sterile PBS and centrifugated at 13,000×g for 10 min three times. Finally, BLPs carrying Venus fused to LysM domains were resuspended in PBS and stored at − 70 °C.
The binding capacity of the recombinant fusion proteins to BLPs027 was evaluated by fluorescence microscopy. For that purpose, 10 μl of the BLP-LysM suspension was let air-dry on a microscope slide. After mounting with Vectashield (Vector, Burlingame, CA) the specimens were examined by fluorescence microscopy using a confocal microscope (LSM 800, Zeiss).
ELISA and stability of the proteins bound to BLPs
An ELISA (Enzyme-Linked ImmunoSorbent Assay) was adapted from Petrovic et al.38, as shown in Fig. S3. Briefly, the BLPs were washed in coating buffer (100 mM NaHCO3, pH 9.6) and suspended in the same buffer at a concentration of 2.5 × 109 particles/ml. Then, 100 µl of the BLP suspension was added to a 96-well polystyrene plate and incubated overnight at 37 °C. The wells were blocked with 1.5% gelatin (Sigma-Aldrich) in Tris buffer added with 1% Tween (TBST) for 1 h 30 min at 37 °C and subsequently washed with TBST as shown in Fig. S3. Then, 50 µl of the purified Venus-LysM fusion proteins (Acglu or Pgb) were added, with concentrations ranging between 1.5 × 10–3 and 1.5 × 10–6 µmol/ml, incubated for 2 h at 37 °C and subsequently they were washed three times with TBST. Finally, 100 µl of the diluted murine α-RGS-HIS antibody (1:2000, Sigma-Aldrich) was added, followed by a 2 h incubation at 37 °C and three washing steps with TBST. Peroxidase-conjugated anti-mouse antibody (α-Mo Pox 1:1000, Dako) was added and incubated for 1 h at 37 °C. After three TBST washing steps, the reaction was developed using TMB (Sigma-Aldrich) as a substrate and the A450 nm was measured on a microplate reader.
The stability of the proteins bound to LysM was determined under different conditions, including temperature (4, 25 and 37° C), NaCl molarity (1, 3, and 5 M), urea molarity (2, 4, 6, and 8 M) and pH (4, 7.4 and 9). For this purpose, different wash buffers were prepared using the mentioned conditions and after adding the solutions of the respective purified LysM proteins (1.5 × 10–3 μmol/ml), the wells were washed three times using the corresponding buffer. The final wash was done with TBST and the ELISA protocol was continued as previously described (Fig. S3).
Construction of a customized pDEST vector
In order to label an antigen of interest with the Acglu domain, a personalized pDEST vector was constructed by traditional cloning following the procedure detailed in Fig. S4. The five LysM domains in Acglu were amplified from L. fermentum IBL038 genomic DNA using the following pair of primers: Acglu5-Fw: GGTAAGCTTATAGGAGGGCCACCATGAGAGGATCTCACCACCACCACGTCCAATCCGGCGACAC and Acglu5-Rv: GATATCACAAGCGATAACTGTTGACC. The purified product, 5′-HindIII-ATG-[RGS-His-tag-Acglu]-EcoRV-[ccdB/CmR (rfb)]-EcoRV-XbaI-3′, was ligated into the pETG-N-RGS-His-[rfb] vector by using a T4 DNA ligase (New England Biolabs). Reactions were incubated overnight at 4 °C and subsequently transformed into chemically competent E. coli DB3.1 the integrity of the resulting pENHAC-[rfb] vector was verified by HindIII/XbaI (New England Biolabs) restriction analysis.
Preparation of Acglu-Venus-BLP027 vaccine
Venus was cloned into the pENHAC-[rfB] vector using LR clonase (Gatewayrecombinatorial cloning) as described before. The recombinant fusion protein Acglu-Venus was induced in E. coli Rosetta with 2 mM IPTG. After sonication and centrifugation, the cell-free extract was mixed with BLPs027 as described in 4.4. The amount of bound protein was compared to BSA standards by SDS-PAGE.
Immunization of mice
Six-week-old male Balb/c mice were obtained from a closed colony kept at CERELA-CONICET (Tucuman, Argentina). Five groups of five animals each were housed separately according to each treatment. All groups were fed a conventional balanced diet ad libitum.
Group 1, used as control group, only received 108 particles/mouse resuspended in 20 µl of PBS. Groups 2 and 3 were immunized intranasally with Venus-Acglu-BLPs027 (108 particles/mouse) using 20 or 40 μg of Venus-Acglu (Venus-Acglu20-BLPs027 and Venus-Acglu40-BLPs027 groups, respectively). Group 4 was nasally immunized with 40 μg of Venus-Acglu alone and group 5 was immunized intraperitoneally with 20 μg of Venus-Acglu with 100 µl complete Freund’s adjuvant (1 mg/ml, Sigma-Aldrich). All groups of animals were immunized on day 0 and then received two booster vaccinations on days 14 and 28 (Fig. S5).
Antibody detection in serum and broncho-alveolar lavage (BAL) and splenocytes cytokines production
Blood and BAL samples were taken 10 days after 2nd boosting as described previously 39.
Specific anti-Venus total immunoglobulins (IgT), IgA and IgG were determined by ELISA. Plates were coated with 3 μg recombinant His-Venus per well overnight at 4 °C and blocked with BSA. Appropriate dilutions of the samples (serum 1:20; BAL 1:2) were incubated for 1 h at 37 °C. Peroxidase conjugated anti-mouse IgT (Polyclonal rabbit anti-mouse immunoglobulins/HRP, DakoCytomation) IgG, or IgA antibodies (Sigma-Aldrich) (at a 1:500 dilution) were added and incubated for 1 h at 37 °C. The reaction was developed with TMB Substrate Reagent (Sigma-Aldrich) and measured at 450 nm in a microplate reader.
Spleens were collected, mechanically disaggregated and the cell suspensions were kept as previously described 11. Cells (4 × 106 cells/well) were cultured in 24-well plates in the presence of 0.5 μg of His-Venus for 24 h. Tumor necrosis factor (TNF)-α, interferon (IFN)-γ, interleukin (IL)-4 and IL-17 concentrations in spleen supernatants were measured with commercially available ELISA kits following the manufacturer’s recommendations (R&D Systems).
Statistical analysis
Experiments were performed in triplicate and results were expressed as mean ± standard deviation (SD). After verification of the normal distribution of data, two-way ANOVA was used. Tukey’s test (for pairwise comparisons of the means) was used to test for differences between the groups. Differences were considered significant at p < 0.05.
Ethical statement
All methods were carried out in accordance with relevant guidelines and regulations. Animal experiments were performed in strict accordance with the ARRIVE guidelines. All experiments were approved by the Ethical Committee of Animal Care at CERELA-CONICET.
