In vivo anti-tumor assay
All animal experiment protocols were approved by the Institutional Review Committee of Shanghai Jiao Tong University, School of Biomedical Engineering. The approval number is 2019008. In this study, ten BALB/c female mice aged 8 weeks were selected and randomly divided into two groups. JM2 powders were dissolved in PBS to obtain the JM2 intratumoral injection solution with a concentration of 2.5 mg mL−1. 4T1 cells were collected, resuspended in PBS and 2 × 105 cells were subcutaneously inoculated into the right-back of each mouse. After 4 days, the mice in the control group and JM2 group were administrated with 50 µL PBS or JM2 (2.5 mg kg−1) every 3 days. Then, the body weight of the mice and tumors were measured every 2 days. The relative tumor volumes were calculated according to the formula V [mm3] = ab2/2, where a and b are the length and width of the tumors, respectively.
On day 14, all mice were sacrificed, and the tumor tissues were collected and photographed before they were fixed with 4% paraformaldehyde (PFA), embedded in paraffin, and sectioned into slices. Part of tumor tissue section samples was dewaxed and stained with hematoxylin and eosin (Yeasen, China). The stained slices were observed with an optical microscope (Leica DMI 3000B, Germany) and photographed by using a CCD camera connected to the microscope.
In addition, proliferation of cells in tumor tissues were detected by staining the tissue sections with a cellular proliferation marker, Ki67. Briefly, hydrated slices were antigen heat repaired by 0.01 M heated sodium citrate buffer. Then, the slices were incubated with 0.3% H2O2/methanol for 30 min before they were incubated with 5% bovine serum albumin (BSA, Sigma, USA)-PBS solution for 1 h and incubated with primary antibody of rabbit anti-Ki67 (1:200, Abcam, UK) overnight. After that, the slices were incubated with HRP-conjugated goat anti-rabbit secondary antibody (Abcam, UK) and then incubated with the DAB solution in a DAB substrate kit (Abcam, UK). The tissue sections were further stained with hematoxylin before they were observed under the optical microscope.
Moreover, apoptotic cells in tumor tissues were detected by TUNEL apoptosis detection kit (Yeasen, China) according to the instruction. Briefly, the hydrated slices were incubated with 20 µg mL−1 Proteinase K-PBS solution before they were incubated with equilibration buffer. Meanwhile, 50 µL system TdT incubation buffer was prepared according to the instruction. After that, the equilibration buffer was replaced by TdT incubation buffer and incubated at 37 °C. The nuclei of the cells were stained with 5 µg mL−1 4,6-diamidino-2-phenylindole (DAPI). Finally, the TUNEL-stained slices were observed and photographed with a camera (Leica DFC 420 C) connected to a confocal laser scanning microscope (Leica SP5, Germany).
Cell culture
B16F10 melanoma cell lines were purchased from Zhong Qiao Xin Zhou Biotechnology Co., Ltd (Shanghai, China) and 4T1 cell lines were acquired from the Shanghai Institute of Cell Biology of the Chinese Academy of Sciences (Shanghai, China). B16F10 cells were cultured with RPMI-1640 culture medium (ZQ-201, Zhong Qiao Xin Zhou Biotechnology Co., Ltd, Shanghai, China) and 4T1 cells were cultured with Dulbecco’s Modified Eagle Medium (DMEM, Gibco) containing 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin (P/S).
JM2 mimic peptide preparation
The JM2 mimic peptide was designed based on our previous study, containing a poly-d-arginine internalization vector, a Cx43 microtubule-binding domain, and a cysteine residue at the C-terminal end (JM2, rrrrrrrr-VFFKGVKDRVKGRSDC). In order to observe the position of JM2 in cells, the JM2 mimic peptide was labeled with FITC fluorescein on its N-terminal (FITC-JM2, FITC-rrrrrrrr-VFFKGVKDRVKGRSDC). The JM2 and FITC-JM2 mimic peptide was customized and synthesized by GL Biochem Ltd (Shanghai, China).
Effects of JM2 on proliferation and cytotoxicity of tumor cells
Cell proliferation assay
Before all experiments, JM2 solutions with different concentrations were prepared. JM2 powders were dissolved in the normal cell culture medium (RPMI-1640 or DMEM) to obtain JM2 solutions with concentrations of 50, 100, 150, 200 µg mL−1, respectively. Then, the JM2 solutions were filtered and sterilized with 0.22 µm filters (Millipore, USA). In subsequent in vitro cell experiments, JM2 solutions with different concentrations were prepared by this way unless otherwise noted. B16F10 or 4T1 cells were seeded in 48-well plates at a density of 1 × 104 cells per well and cultured in a humidified 5% CO2 incubator at 37 °C. After 12 h, the culture medium was discarded and cells were washed with PBS. Then, 200 µL fresh normal cell culture medium containing 20 µL Cell Counting Kit-8 (CCK-8, Beyotime, China) solution was added into each well and the cells were further cultured for 1.5 h. The absorbance of cells at 450 nm was measured by a microplate reader (Synergy 2, Bio-TEK). Then, the cells were washed with PBS and cultured with JM2 solutions with concentrations of 50, 100, 150, 200 µg mL−1 for another 1 and 3 days. RPMI-1640 and DMEM was used as the culture medium in the control group for B16F10 and 4T1 cells, respectively. At predetermined culture time points, the culture medium was discarded and cells were cultured with normal culture medium containing CCK-8 for 1.5 h. The absorbance of cells at 450 nm was measured by a microplate reader. Finally, the cell proliferation inhibition rate was calculated by the formula CV = (1 − ODExperimental group/ODControl group) × 100%. Three independent experiments were carried out for validation.
Lactate dehydrogenase (LDH) release assay
In this experiment, JM2 solutions with different concentrations were prepared by using culture medium containing 1% FBS. B16F10 or 4T1 cells were seeded in 96-well plates at a density of 1 × 104 cells per well and cultured for 12 h. Then, the culture medium was discarded and replaced by JM2 solutions with concentrations of 50, 100, 150, 200 µg mL−1. RPMI-1640 and DMEM containing 1% FBS was used as the culture medium in the control group for B16F10 and 4T1 cells, respectively. Wells with no cells but containing culture medium were considered as blank group. After 24 h, the plate was centrifuged at 400 × g for 5 min, and 120 μL supernatants per well were transferred to wells in another new 96-well plate. The LDH detection working solution was prepared according to the manufacturer’s instructions. Sixty microliters LDH detection working solution was added to each well and the plate was incubated at room temperature for 30 min. Then, the absorbance of the mixture at 490 nm was measured by a microplate reader. Finally, relative LDH release (RLR) was calculated by the formula RLR = (ODExperimental group – ODBlank group)/(ODControl group – ODBlank group). Three independent experiments were carried out for validation.
Colony formation assay
B16F10 or 4T1 cells were seeded in 6-well plates at a density of 1.5 × 105 cells per well and cultured for 12 h. Then, the culture medium was replaced by JM2 solutions with concentrations of 50, 100, 150, 200 µg mL−1. After 24 h, the cells treated with JM2 solutions with different concentrations were detached with trypsin and collected separately. The collected cells were seeded in 6-well plates at a density of 200 cells per well and cultured for 10 days. Cells treated without JM2 solutions were used as control group. Finally, the cells were fixed in 4% PFA and stained with crystal violet. The cells in the plates were photographed and the colonies formed were counted. According to the cell proliferation assay, LDH release assay and colony formation assay, the effective concentrations of JM2 solutions can be determined and used for subsequent in vitro experiments. Three independent experiments were carried out for validation.
Effects of JM2 on migration and invasion of tumor cells
In vitro scratch assay
In this experiment, JM2 solutions with different concentrations of 50, 100, and 150 µg mL−1 were prepared by using serum-free culture medium or low serum culture medium (serum-free RPMI-1640 or 1% FBS DMEM). 4T1 cells were sensitive in serum-free medium and easily fall off the bottom of the well. B16F10 or 4T1 cells were seeded in 24-well plates at a density of 5 × 104 cells per well and cultured for 24 h. Then, cell culture medium was discarded and the monolayer of cells was scratched vertically in a straight line by using 200 µL pipette tips on the bottom of each well. Then, the cells were washed twice with PBS and cultured with JM2 solutions with different concentrations for 12 and 24 h. Serum-free RPMI-1640 and 1% FBS DMEM was used as the medium for B16F10 and 4T1 cells in control group, respectively. At the predetermined time, the scratches were photographed by using a digital camera (Leica DFC 420C) connected with an inverted microscope (Leica DMI 3000B, Germany).
In vitro transwell migration/invasion assay
The migration ability of B16F10 and 4T1 cells was assessed by using a Transwell chamber assay. B16F10 and 4T1 cells were collected and resuspended in serum-free RPMI-1640 or serum-free DMEM medium, respectively, at a density of 3 × 105 cells mL−1. One hundred microliters of cell suspension was added to the upper of the Transwell chamber (pore size 8 μm, Corning, USA), and 600 μL of JM2 solutions with different concentrations of 50, 100, and 150 µg mL−1 were loaded into the lower chambers in 24-well plates. RMPI-1640 and DMEM culture medium were used as the control group for B16F10 and 4T1 cells, respectively. After 6 h, the culture medium in the upper chamber was discarded and the cells in the upper chamber were wiped off. The cells migrating through the polycarbonate membrane were fixed with 4% PFA for 10 min, followed by staining with crystal violet for 20 min. Finally, the cells were washed twice with PBS. The cells passing through the polycarbonate membrane were photographed and counted by using a digital camera connected with an inverted microscope. Three independent experiments were carried out for validation.
The invasive ability of B16F10 and 4T1 cells was evaluated by using a Matrigel-assisted Transwell chamber assay. Matrigel was used to imitate extracellular matrix in vivo. Tumor cells need to secrete MMPs to degrade the Matrigel before they pass through the polycarbonate membrane of Transwell chamber. Therefore, the number of cells passing through the membrane reflect the invasion ability of tumor cells. In this experiment, JM2 solutions with different concentrations of 50, 100, and 150 µg mL−1 were prepared by using serum-free culture medium or low serum culture medium (serum-free RPMI-1640 or 1% FBS DMEM). In details, Matrigel (BD Biocoat, 356234) was diluted with ice-cold serum-free RPMI-1640 and serum-free DMEM at a ratio of 1:8 and 100 μL of diluted Matrigel was added to the upper chamber of the Transwell in a 24-well plate. All of the above steps were conducted on ice. Then, the 24-well plate was placed at 37 °C and incubated overnight to convert the Matrigel solution into a gel. B16F10 and 4T1 cells were collected and resuspended in serum-free or low serum JM2 solutions with different concentrations at the cell density of 1 × 106 cells mL−1. Then, 100 μL of the cell suspension was added into the upper chamber of Transwell and 600 μL of RPMI-1640 or DMEM was added to the lower chamber of the 24-well plate. For the control group, 100 μL of the cell suspension resuspended in serum-free RPMI-1640 or DMEM was added to the upper chamber and 600 μL of RPMI-1640 or DMEM was added to the lower chamber. After 24 h, the culture medium and Matrigel in the upper chamber were discarded and the cells in the upper chamber were removed with a cotton swab. The cells migrating through the polycarbonate membrane were fixed with 4% PFA and stained with crystal violet. Finally, the cells were photographed and counted by using a digital camera connected with an inverted microscope. Three independent experiments were carried out for validation.
Intracellular localization of JM2 and mitochondria
Intracellular localization of JM2
In this experiment, FITC-JM2 solution with a concentration of 150 µg mL−1 was prepared by dissolving FITC-JM2 powder in RPMI-1640 or DMEM culture medium. B16F10 or 4T1 cells were seeded in glass bottom cell dish (Nest, 801002, China) at a density of 2 × 104 cells per dish and cultured for 24 h. Then, the culture medium was replaced by 150 µg mL−1 FITC-JM2 solution. After 4 h, the culture medium was discarded and the cells were washed twice with PBS. Then, the cells were fixed with 4% PFA for 10 min and permeabilized with 0.3% triton-x100 for 5 min. After that, the cells were blocked with 1% BSA-PBS solution at 37 °C. The cells were incubated with mouse anti-α-tubulin (Sigma, USA) primary antibody (diluted with 0.5% BSA-PBS solution at the ratio of 1:300) and kept at 4 °C overnight. The cells were then washed with PBS for three times and stained with Alexa 594 goat anti-mouse IgG (Invitrogen, USA) (diluted with 0.5% BSA-PBS at the ratio of 1:1000). At the end of the incubation, the cells were washed with PBS before the nuclei of the cells were stained with 5 µg mL−1 DAPI solution. Finally, the stained cells were observed and photographed with a camera connected to a confocal laser scanning microscope. The PCC and the MOC were analyzed to quantify the degree of colocalization between JM2 and microtubules. Three independent experiments were carried out for validation.
Intracellular localization of mitochondria
B16F10 and 4T1 cells were seeded on coverslips fitted in 24-well plates at a density of 3 × 104 cells per well and cultured for 24 h. Then, the culture medium was replaced by 150 µg mL−1 JM2 solution. The cells cultured with RPMI-1640 or DMEM were considered as the control group for B16F10 and 4T1 cells, respectively. After 4 h, the culture medium was discarded and the cells were washed twice with PBS. Co-immunofluorescence staining of TOMM20 and α-tubulin was performed according to the method in Intracellular localization of JM2. The primary antibody of TOMM20 rabbit monoclonal antibody (Beyotime, China) and mouse anti-α-tubulin (Sigma, USA) were diluted with 0.5% BSA-PBS solution at the ratio of 1:300. The cells were then incubated with mixed primary antibody solution and kept at 4 °C overnight. After that, the cells were stained with a mixture of Alexa 488 goat anti-rabbit IgG (Invitrogen, USA) and Alexa 594 goat anti-mouse IgG (Invitrogen, USA) diluted at the ratio of 1:1000, and the nuclei of the cells were stained with 5 µg mL−1 DAPI solution. Finally, the stained cells were observed and photographed with a camera connected to a confocal laser scanning microscope. The PCC and the MOC were analyzed to quantify the degree of colocalization between mitochondria and microtubules. Three independent experiments were carried out for validation.
Assessments of intracellular ROS and mitochondrial superoxide production
Intracellular ROS and mitochondrial superoxide were assessed by using H2O2-sensitive probe, 2,7-Dichlorodi-hydrofluorescein diacetate (DCFH-DA) or mitochondrial superoxide probe, MitoSOX red. B16F10 and 4T1 cells were seeded on coverslips fitted in 24-well plates at a density of 3 × 104 cells per well and cultured for 12 h. Then, the culture medium was replaced by JM2 solutions with concentrations of 50, 100 and 150 µg mL−1. The cells cultured with RPMI-1640 or DMEM were considered as the control groups. DCFH-DA or MitoSOX red was diluted with serum-free RPMI-1640 or DMEM culture medium at a ratio of 1:1000 to a final concentration of 10 μmol L−1 or 2 μmol L−1. After 24 h, the culture medium was discarded and 250 μL diluted DCFH-DA or MitoSOX red solution was added to each well. The plate was incubated at 37 °C for 20 min before the cells were washed three times with serum-free cell culture medium. Then, the cells treated with DCFH-DA were immediately observed and photographed with a camera connected to a confocal laser scanning microscope. In addition, B16F10 or 4T1 cells were seeded in 6-well plates at a density of 1.5 × 105 cells per well and cultured for 12 h. Then, same cultures and treatments to the above procedures were applied to the cells before they were detached with trypsin and resuspended in 500 μL PBS for flow cytometric analysis by using a flow cytometer (FACS AriaII, BD). Three independent experiments were carried out for validation.
Determination of cell apoptosis
Mitochondrial membrane potential detection
The change of mitochondrial membrane potential is a sign of mitochondrial dysfunction, and the decrease of mitochondrial membrane potential is a landmark event in the early stage of apoptosis [31]. A mitochondrial membrane potential assay kit with JC-1 (Beyotime, China) was used to monitor the changes of mitochondrial membrane potential. When the mitochondrial membrane potential is relatively normal, JC-1 gathers in the matrix of the mitochondria to form red-fluorescencent aggregates. When the mitochondrial membrane potential is decreased, JC-1 cannot accumulate in the matrix of the mitochondria and exists as green-fluorescencent monomer. B16F10 or 4T1 cells were seeded in glass bottom cell dish at a density of 2 × 104 cells per dish and cultured for 12 h. Then, the culture medium was replaced by JM2 solutions with concentrations of 50, 100 and 150 µg mL−1. Meanwhile, JC-1 staining working solution was prepared according to the instruction. After 24 h, the culture medium was replaced by 1 mL fresh culture medium and 1 mL JC-1 staining working solution. The cells were further incubated at 37 °C for 20 min and JC-1 staining buffer was prepared according to the instruction during the incubation period. The JC-1 staining working solution was discarded and the cells were washed twice with JC-1 staining buffer. At the end, the cells were immediately observed and photographed with a camera connected to a confocal laser scanning microscope. Image J software was used to quantify the red and green fluorescence, and the ratios of red/green (aggregation/monomer) were calculated. Three independent experiments were carried out for validation.
Cell apoptosis assay
B16F10 and 4T1 cells were seeded in 12-well plates at a density of 5 × 104 cells per well and cultured for 12 h. Then, the culture medium was discarded and the cells were cultured with JM2 solutions with concentrations of 50, 100, 150 µg mL−1 for 24 h. B16F10 and 4T1 cells cultured with RPMI-1640 or DMEM were regarded as the control groups. After 24 h, the cell culture medium was discarded and the cells were washed with PBS. 300 µL of Hoechst 33258 staining solution was added and the cells were incubated at room temperature for 5 min. Then, the staining solution was discarded and the cells were washed with PBS. At the end, the cells were immediately observed and photographed by using a digital camera connected with an upright microscope.
Meanwhile, flow cytometry was used to detect cell apoptosis. B16F10 and 4T1 cells were seeded in 6-well plates at a density of 1.5 × 105 cells per well and cultured for 12 h. Then, the culture medium was discarded and the cells were cultured with JM2 solutions with concentrations of 50, 100, 150 µg mL−1 for 24 h. B16F10 and 4T1 cells cultured with RPMI-1640 or DMEM were regarded as the control group. After 24 h, the cell culture medium and the cells were collected. The cells were resuspended for staining according to the instruction in Annexin V-FITC/PI Apoptosis Detection Kit (Yeasen, China). Briefly, the cells were resuspended in Annexin-FITC binding buffer and added with 5 μL Annexin V-FITC and 10 μL PI staining solution. Then, the cells were incubated at room temperature in dark for 20 min. Finally, the samples were analyzed by using a flow cytometer. Three independent experiments were carried out for validation.
In addition, in order to verify the effect of ROS generated in cells on cell apoptosis, the antioxidant NAC was used in this experiment. B16F10 or 4T1 cells were seeded in 6-well plates at a density of 1.5 × 105 cells per well and cultured for 12 h. The cells were divided into four groups according to different cell culture medium, including control group (RPMI-1640 or DMEM), JM2 group (100 µg mL−1 JM2 solution), JM2 + NAC group (100 µg mL−1 JM2 solution and 5 mM NAC), NAC group (5 mM NAC). For the JM2 + NAC group and the NAC group, 5 mM NAC was added 2 h in advance. Subsequently, 100 µg mL−1 JM2 solution was added to the JM2 group and the JM2 + NAC group. All cells were further cultured for 24 h. Then, the cell culture medium and the cells were collected. The collected cells were stained via the aforementioned staining method by using Annexin V-FITC/PI Apoptosis Detection Kit. Finally, the samples were placed on ice and analyzed by using a flow cytometer. Three independent experiments were carried out for validation.
Caspase 3 activity assay
It is generally believed that Caspase 3 is the most important terminal shearing enzyme in the process of cell apoptosis, and it plays an irreplaceable role in cell apoptosis [32]. Caspase 3 activity assay kit (Beyotime, China) was used to detect the activity of the Caspase 3 enzymes in B16F10 and 4T1 cells. Caspase 3 can catalyze the substrate Ac-DEVD-pNA to produce yellow pNA, so the activity of Caspase 3 can be detected by measuring the absorbance. B16F10 and 4T1 cells were cultured according to the method in Cell apoptosis assay and the cells were incubated with 100 µg mL−1 JM2 solution. After 24 h of incubation, the cell culture medium and the cells were collected and resuspended in 100 µL lysis buffer and placed on ice for 15 min. Subsequently, the cells were centrifuged at 20,000 × g for 15 min to obtain the supernatant for Caspase 3 enzyme activity determination. According to the instructions in the Caspase 3 activity assay kit, 40 µL detection buffer, 50 µL sample and 10 µL Ac-DEVD-PNA were added successively to each well of the 96-well plate. Then, the plate was placed in a 37 °C incubator and incubated for 120 min. The absorbance of mixtures at 405 nm was measured by a microplate reader. The Bradford (Beyotime, China) method was used to detect the total protein concentration of the samples. Coomassie brilliant blue combines with arginine in protein and turns into blue after being combined in an acidic medium, and the color change is directly proportional to the protein concentration. In brief, 5 µL samples and 250 µL Coomassie brilliant blue staining solution were added to the wells in 96-well plate. The absorbance of mixtures at 595 nm was measured by a microplate reader. The concentration of Caspase 3 and the concentration of total protein in supernatant were calculated. The concentration of Caspase 3 per mg protein in the control group and the JM2 experimental group was calculated. The relative activity of Caspase 3 was presented as the multiple of the caspase activity of the JM2 experimental group relative to the control group. Three independent experiments were carried out for validation.
Cell cycle detection assay
B16F10 and 4T1 cells were seeded in 6-well plates at a density of 1.5 × 105 cells per well and cultured for 12 h. The culture medium was then replaced by serum-free RPMI-1640 or serum-free DMEM. After 24 h, the cells were treated according to the method in Cell apoptosis assay. The collected cells were fixed in a mixed solution containing 300 µL ice-cold PBS and 700 µL cold ethanol at 4 °C for 2 h. At the same time, the staining working solution was prepared according to the instruction of the Cell Cycle and Apoptosis Analysis Kit (Beyotime, China). The cells were resuspended in the staining working solution and incubated for 30 min in dark. Finally, the cell suspension was filtered with a 300-mesh screen and the DNA content was measured by using a flow cytometer. Three independent experiments were carried out for validation.
Quantitative real-time polymerase chain reaction (Q-RT-PCR) analysis
In order to detect the effects of JM2 on gene expression of cell migration and invasion-related proteins, cell apoptosis-related proteins, and cell cycle-related proteins, Q-RT-PCR assays were performed. B16F10 and 4T1 cells were seeded and cultured according to the method in Cell apoptosis assay. Then, the cells were collected, and the total RNA was extracted with E.Z.N.A. Total RNA kit I (OMEGA, Biotek). The RNA concentration was measured with Nanodrop 1000 reader (Thermo, USA) and cDNA was prepared in the process of reverse transcription by using Hifair® II 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) (Yeasen, China). Subsequently, cDNA was diluted with sterilized deionized water at the ratio of 1:10. A 10 μL system was loaded in a 384-well plate including 4.2 μL diluted cDNA mixed with 0.4 μL primer F, 0.4 μL primer R and 5 μL of Hieff® qPCR SYBR Green Master Mix (High Rox) (Yeasen, China). The Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene and the sequences of each primer utilized in the experiment were summarized as follows (all primers were purchased from Sangon Biotech Co. Ltd., China). Finally, the mixed solution of cDNA and primers was analyzed via the 7900 real-time PCR system (Applied Biosystems). The results were analyzed by the 2−ΔΔCt method using the SDS 2.4 software. The gene expression was normalized to the gene expression of GAPDH and compared to the control group. Three independent experiments were carried out for validation.
Sequences
MMP2 (F): ACTTTGAGAAGGATGGCAAGTA
MMP2 (R): CTTCTTATCCCGGTCATAGTCC
MMP9 (F): CAAAGACCTGAAAACCTCCAAC
MMP9 (R): GACTGCTTCTCTCCCATCATC
Bax (F): TTGCCCTCTTCTACTTTGCTAG
Bax (R): CCATGATGGTTCTGATCAGCTC
Bcl-2 (F): GATGACTTCTCTCGTCGCTAC
Bcl-2 (R): GAACTCAAAGAAGGCCACAATC
cyclin A (F): CTGCTAGCTTCGAAGTTTGAAG
cyclin A (R): CATTCTCAGAACCTGCTTCTTG
cyclin E (F): GCACCAGTTTGCTTATGTTACA
cyclin E (R): GGGCCTTCATCATCATCAATTC
GAPDH (F): GATTTGGTCGTATTGGGCG
GAPDH (R): CTGGAAGATGGTGATGG
Western blot analysis
To ulteriorly explore the effects of JM2 on mitochondria-mediated cell apoptosis-related proteins, western blot assays were performed. B16F10 and 4T1 cells were cultured and treated according to the method in Cell apoptosis assay. The collected cells were lysed by using RIPA lysis buffer (Yeasen, China) containing protease inhibitor cocktail (Beyotime, China) and phosphatase inhibitor cocktail (Sigma, USA). The lysates were centrifuged at 12,000 × g for 10 min and the supernatants were collected. BCA Protein Quantification Kit (Yeasen, China) was used to quantify the protein in the collected supernatants. The protein samples were mixed with 5× loading buffer and denatured by heating in metal bath for 5 min. Equal amounts of protein samples were separated by 10 or 12% SDS-PAGE gels and transferred to PVDF membranes. After blocked with blocking buffer (Beyotime, China) for 1 h, the membranes were incubated with primary antibodies against Bax (Beyotime, China), Bcl-2 (Beyotime, China), Cytochrome C (Beyotime, China), Cleaved-Caspase 3 (Cell Signaling Technology, USA), Pro-Caspase 3 (Beyotime, China) and GAPDH (Abcam, UK) diluted at the ratio of 1:1000 at 4 °C overnight. Then the membranes were incubated with horseradish peroxidase (HRP) ‐conjugated secondary antibodies diluted at the ratio of 1:1000 for 4 h on ice. The membranes were dropped with BeyoECL Plus solution (Beyotime, China) and photographed with a Tanon-5200 GelCap ECL system (Shanghai, China). Three independent experiments were carried out for validation.
In vivo tumor recurrence inhibition assay
First of all, freeze-dried JM2 grafted HA were prepared according to our previous research [33]. The freeze-dried JM2 grafted HA was sterilized under UV lamp for 30 min and mixed with photoinitiator LAP (Sigma, USA) at a ratio of 9:1. Then, the mixture was dissolved in PBS. Two hundred microliters mixture solution was injected in plastic molds with different shapes and exposed to the irradiation of UV light (365 nm, Scientz Biotechnology Co., Ltd) for 10 s to crosslinked into HA-JM2 hydrogels. In addition, in order to verify whether the obtained HA-JM2 hydrogels can exert a tumor inhibitory effect, the effect of HA-JM2 hydrogel on the proliferation of B16F10 and 4T1 cells was explored by using a CCK-8 kit. Briefly, B16F10 or 4T1 cells were seeded in 24-well plates at a density of 3 × 104 cells per well and cultured for 12 h. The culture medium was discarded and cells were washed with PBS. 100 μL HA or HA-JM2 solution was added to the upper of the Transwell chamber and exposed to the UV light for 10 s before 600 μL RMPI-1640 or DMEM was loaded into the lower chamber in a 24-well plate. RMPI-1640 and DMEM culture medium was used as the control medium for B16F10 and 4T1 cells, respectively. On days 0, 1, and 3, the culture medium was removed and cells were further cultured with normal culture medium containing CCK-8 for 1.5 h. The absorbance of the cells at 450 nm was measured with a microplate reader and the ability of HA and HA-JM2 hydrogels to inhibit tumor cell proliferation was analyzed.
Then, a mouse model of in situ resection of breast tumor was constructed. Sixteen BALB/c female mice aged 8 weeks were selected and the fourth pair of breasts were injected with 2 × 105 4T1 cells in situ. After 10 days, these tumor-bearing mice were randomly divided into four groups, including tumor excision treated with nothing (control), tumor excision treated with JM2 solution, tumor excision treated with HA hydrogels, and tumor excision treated with HA-JM2 hydrogels. Tumor tissue with a volume of 20 mm3 was intentionally left at the wound sites. According to the divided groups, JM2 solution, HA hydrogels, and HA-JM2 hydrogels were applied to the wounds of each group respectively. During the treatment, the hydrogel dressings were changed on day 3 and 6. On days 0 and 12, the wounds were photographed and all the mice were sacrificed on day 12. Then, the tissues were extracted the fixed with 4% PFA, embedded in paraffin, and sectioned into slices. The slices were dehydrated and used for H&E staining and Ki67 immunofluorescence staining. The H&E staining samples were observed by using an optical microscope and images were taken with a CCD camera connected to the microscope. Ki67 immunofluorescence staining was performed according to the method in In vivo anti-tumor assay. The slices were incubated with primary antibody at 4 °C overnight and then incubated with Alexa 488 goat anti-rabbit IgG for 2 h. The nuclei of the cells were stained with 5 µg mL−1 DAPI solution and the stained cells were observed and photographed with a camera connected to a confocal laser scanning microscope. Image J software was used to calculate the Ki67-positive cells.
Statistical analysis
At least three independent experiments were carried out for statistical analysis. All the experimental data were expressed as means ± standard deviation. Figures 3d, 4b, 6–d were used Student’s t test to evaluate the significant difference between two groups. Figures 1c, d, 2a, 7b were used two-way analysis of variance (ANOVA) for statistical differences. Figures 2b, c, 3b, c, 4d–f, 5a, c, d, 6e, 7e, g were used one-way ANOVA for statistical differences. PASS 15 software was used to perform power analysis on experimental data to test whether the number of test repeats used in experiments is sufficient. *p < 0.05 and **p < 0.01 indicates statistically significant difference while p > 0.05 was considered as no obvious significant difference (n.s).
