Ethics statement
The Institutional Biosafety Committee (IBC) at the University of California, Irvine (UCI), has reviewed and approved the cell line experiments described in this study. The study was also conducted in accordance with NIH Guidelines and UCI Policy.
Mice
The rd12 mice and C57BL/6J mice were purchased from the Jackson Laboratory (Jackson Laboratory; Bar Harbor; 005379 and 000664, respectively). Gnat1−/− mice were a generous gift from Janet Lem (Tufts University, Boston). Rd12Gnat1−/− mice were generated by crossbreeding Gnat1−/− mice with rd12 mice. Progeny was genotyped as described previously42. The homozygosity of the rd12 mutation was validated by Transnetyx genotyping. The age, strain, and the number of animals used for each experiment are stated in the corresponding figure captions. The ratio of males to females was relatively equal in all experiments. All mice were housed in the vivarium at the University of California, Irvine, where they were maintained on a normal mouse chow diet and a 12 h/12 h light (<10 lux)/dark cycle. The temperature ranged from 75 to 76 °F, and the humidity from 30 to 40%. All animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of California, Irvine, under Protocol #AUP-21-096 and were conducted in accordance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Visual Research.
Cell line generation
A stable cell line expressing a mouse RPE65rd12 variant was generated by transduction of NIH3T3 cells with retrovirus obtained from Phoenix-Eco cells transfected with pMXs-RPE65(rd12)-IRES-GFP according to a previously published protocol43.
In vitro base editing validation
NIH3T3-RPE65 (rd12) cells were seeded on a 24-well plate 18 h prior to transfection. At ~70% confluency, cells were transfected with 750 ng of ABE-expression plasmid and 250 ng of sgRNA-expression plasmid using 1.5 µl of Lipofectamine 3000 (Thermo Fisher, no. L3000001) per well. Four kinds of ABE-expression plasmids were used: pCMV-ABEmax (Addgene plasmid #112095), NG-ABEmax (Addgene plasmid #124163), xABEmax (Addgene plasmid #119813) and pCMV-ABEmax-NRRH23. Two sgRNA-expression plasmids were generated as previously described15. Cells were harvested for genomic DNA purification 48 h post-transfection.
Lentivirus generation for in vivo ABE delivery
To generate a single lentiviral vector co-expressing sgRNA-A6 and NG-ABEmax, the lentiviral transfer plasmid, LV-ABEmax-A6, generated during a previous study15, was double-digested with EcoRI and Eco32I to replace a 2,284-bp sequence with the homologous sequence from NG-ABEmax (Addgene plasmid #124163), double-digested with EcoRI and Eco32I. The final cloned plasmid was packaged into lentivirus particles from Signagen.
AAV generation for in vivo ABE delivery
N-terminal ABE7.10 AAV is identical to that published in a previous study26. To replace the C-terminal AAV plasmid Cas9 variant with SpCas9-NG, first, SpCas9-NG was amplified from NG-ABEmax (Addgene plasmid #124163) with the following primers: forward: TGCTTCGACTCCGTGGAAATCTC and reverse: GACTTTCCTCTTCTTCTTGGGC; and the resulting product was cloned via Gibson assembly into C-terminal ABE7.10 AAV26 that was double-digested with PasI and EcoRI. After sequence confirmation, the plasmid was digested overnight with BsmBI to insert the guide sequence. The guide sequence was ordered as two oligos which were annealed and phosphorylated in vitro before ligation into the cut vector using T4 DNA ligase. The sequences of the two oligos encoding the guide sequence were CACCGACATCAGAGGAGACTGCCAG and AAACCTGGCAGTCTCCTCTGATGTC. Adeno associated viruses expressing the split base editor were produced using the previously described protocol26.
Briefly, HEK293T/17 cells were plated in 15 cm dishes to about 80-85% confluency 24 h before transfection. Cells were then transfected with PEI containing 5.7 μg AAV genome, 11.4 μg pHelper (Clontech), and 22.8 μg of rep-cap plasmid per 15 cm dish. The medium was changed to DMEM with 5% fetal bovine serum 1 day after transfection. The virus was then extracted from cells 72 h after transfection from both the cell lysate and the supernatant. All the viruses were purified with an iodixanol step gradient using a Ti 70 fixed angle rotor at 58,600 rpm for 2 h, 15 min at 4 °C. Ultracentrifugation was followed with buffer exchange and a concentration step using 100-kD MWCO columns (EMD Millipore). The concentrated viral solution was sterile-filtered using a 0.22 μm filter, and stored at −80 °C until use. All viruses were titered via quantitative PCR using the AAVpro Titration Kit v.2 (Clontech), following the manufacturer’s protocol.
Targeted deep sequencing analysis
Genomic DNA (gDNA) from cultured cells or mouse RPE tissue was isolated using the DNeasy Blood and Tissue Kit (Qiagen, no. 69504) or AllPrep DNA/RNA Mini Kit (Qiagen, no. 80284). Total RNA was extracted from the mouse posterior eye cup using AllPrep DNA/RNA Mini Kit (Qiagen, no. 80284). Complementary DNA (cDNA) was synthesized from the total RNA using Superscript III first-strand synthesis SuperMix (Thermo Fisher Scientific, no. 18080400). From gDNA and cDNA templates, 200–300 bp PCR amplicons of on- and off-target predicted sites for Rpe65 were generated using primers with partial Illumina adapter sequences and then purified using the QIAquick PCR Purification Kit (Qiagen, no. 28106). Samples were sequenced on an Illumina MiSeq. Between 70,000 and 100,000 NGS reads for each sample were generated on single-end (1 × 150 bp) or paired-end (2 × 250 bp) runs. Primers used for off-target analysis are listed in Table S2.
CIRCLE-seq off-target editing analysis
Genomic DNA from rd12 mouse tissue was isolated using the Gentra Puregene Tissue Kit (Qiagen, no. 158667), according to the manufacturer’s protocol. CIRCLE-seq was performed as previously described25,44. Briefly, purified genomic DNA was sheared with a Covaris S2 instrument to an average length of 300 bp. The fragmented DNA was end-repaired, A-tailed, and ligated to a uracil-containing stem-loop adaptor, using KAPA HTP Library Preparation Kit, PCR Free (KAPA Biosystems). Adaptor-ligated DNA was treated with Lambda Exonuclease (NEB) and E. coli Exonuclease I (NEB) and then with USER enzyme (NEB) and T4 polynucleotide kinase (NEB). Intramolecular circularization of the DNA was performed with T4 DNA ligase (NEB) and residual linear DNA was degraded by Plasmid-Safe ATP-dependent DNase (Lucigen). In vitro cleavage reactions were performed with 250 ng of Plasmid-Safe-treated circularized DNA, 90 nM of Cas9-NG protein, Cas9 nuclease buffer (NEB), and 90 nM of synthetic chemically modified sgRNA (BioSpring) in a 100 µl volume. Cleaved products were A-tailed, ligated with a hairpin adaptor (NEB), treated with USER enzyme (NEB), and amplified by PCR with barcoded universal primers NEBNext Multiplex Oligos for Illumina (NEB), using Kapa HiFi Polymerase (KAPA Biosystems). Libraries were sequenced with 150-bp paired-end reads on an Illumina MiSeq. CIRCLE-seq data analyses were performed using open-source CIRCLE-seq analysis software (https://github.com/tsailabSJ/circleseq), using the following parameters: read_threshold: 4; window_size: 3; mapq_threshold: 50; start_threshold:3; gap_threshold: 3; mismatch_threshold: 6; search_radius: 30; PAM: NG; merged_analysis: True. The mouse genome GRCm38 was used for alignment.
Mouse subretinal injection
Mice were anesthetized by intraperitoneal injection of a cocktail consisting of 20 mg/ml ketamine and 1.75 mg/ml xylazine in phosphate-buffered saline at a dose of 0.1–0.13 ml per 25 g body weight, and their pupils were dilated with topical administration of 1% tropicamide ophthalmic solution (Akorn, no. 17478-102-12). Subretinal injections were performed using an ophthalmic surgical microscope (Zeiss). An incision was made through the cornea adjacent to the limbus at the nasal side using a 26-gauge needle. A 34-gauge blunt-end needle (World Precision Instruments, no. NF35BL-2) connected to an RPE-KIT (World Precision Instruments, no. RPE-KIT) by SilFlex tubing (World Precision Instruments, no. SILFLEX-2) was inserted through the corneal incision while avoiding the lens and advanced through the retina. Each mouse was injected with 1 μl of viral vector prep per eye. Only mice that had more than 95% retinal coverage after subretinal injection and with minimal complications were kept for further evaluation.
Western blot analysis
To prepare the protein lysate from the mouse RPE tissue, the dissected mouse eyecup, consisting of RPE, choroid, and sclera, was transferred to a microcentrifuge tube containing 30 µl of RIPA buffer with protease inhibitors, homogenized with a motorized tissue grinder (Fisher Scientific, no. K749540-0000) and centrifuged for 30 min at 20,000 × g at 4 °C. The resulting supernatant was pre-cleared with Dynabeads Protein G (Thermo Fisher, no. 10003D) to remove contaminants from blood. Twenty microliters of rd12 cell lysates (15 µl for RPE lysates) were mixed with NuPAGE LDS Sample Buffer (Thermo Fisher, no. NP0007) and NuPAGE Sample Reducing Agent (Thermo Fisher, no. NP0004), incubated at 70 °C for 10 min, separated using a NuPAGE 4–12% Bis-Tris gel (Thermo Fisher, no. NP0321BOX), transferred onto a PVDF membrane (Millipore, no. IPVH00010), followed by blocking for 1 h in 5% (w/v) non-fat milk in PBS containing 0.1% (v/v) Tween-20 (PBS-T). The membrane was incubated with primary antibody diluted in 1% (w/v) non-fat milk in PBS-T overnight at 4 °C. Primary antibodies included mouse anti-RPE65 monoclonal antibody (1:1000; in-house production); mouse anti-Cas9 monoclonal antibody (1:1000; Invitrogen, no. MA523519, clone 7A9); and rabbit anti-β-actin polyclonal antibody (1:1000; Cell Signaling Technology, no. 4970S). After overnight incubation, membranes were washed three times with PBS-T for 5 min each and then incubated with secondary antibody for 1 h at room temperature. Secondary antibodies included goat anti-mouse IgG-HRP antibody (1:5000; Cell Signaling Technology, no. 7076S) and goat anti-rabbit IgG-HRP antibody (1:5000; Cell Signaling Technology, no. 7074S). After washing the membrane three times with PBS-T for 5 min each, protein bands were visualized using Odyssey XF Imaging System (Li-Cor) after exposure to SuperSignal West Pico Chemiluminescent substrate (Thermo Fisher, no. 34580).
Immunohistochemistry of retinal flatmounts and cone quantification
Mouse eyes were fixed with 4% paraformaldehyde in PBS (Santa Cruz Biotechnology, no. 30525-89-4) for 1 h at room temperature and washed three times in PBS for 10 min each. To make retinal flatmounts, the retinal tissue was separated from the anterior segment and posterior eyecup under a dissecting microscope, and four radial cuts were made toward the optic nerve head to flatten the retina. Retinal flatmounts were washed in wash buffer (PBS containing 0.5% Triton X-100 (Sigma-Aldrich, no. X100-5ML) three times for 5 min. To stain cone photoreceptors, retinal flatmounts were incubated with 5% normal donkey serum (Millipore Sigma, no. S30-100ML), polyclonal goat anti-S-opsin (1:500; custom-made by Bethyl Laboratories), and polyclonal rabbit anti-M-opsin (1:500; Novus Biologicals, no. NB110-74730) antibodies in wash buffer for 3 nights at 4 °C. Samples were washed three times for 5 min each in wash buffer and incubated with secondary antibodies, Alexa Fluor 488-conjugated donkey anti-goat IgG (1:250; Abcam, no. ab150129) and Alexa Fluor 647-conjugated donkey anti-rabbit IgG (1:250; Abcam, no. ab150075), for 2 h at room temperature in the dark. After final washing, samples were mounted on slides with VECTASHIELD antifade mounting medium (Novus, no. H-1000-NB). To count the number of S-cones and M-cones in a retinal flatmount, 5 images each of the dorsal and ventral retina were taken, approximately 1 mm away from the optic nerve using a ×40 objective lens in a Keyence BZ-X810 All-in-One fluorescence microscope. Each field (362 × 273 µm) was captured with GFP and Cy5 filters to distinguish S-opsin and M-opsin, respectively. Automated cone quantification in each field was performed using the ImageJ software. All images were converted to RGB stack, and the size and intensity threshold was set to identify cone-opsin-positive cells.
Immunohistochemistry of retinal cryosections
Following enucleation, the cornea and lens were carefully removed under a dissecting microscope while maintaining the shape of the eyecup. The eyecup was fixed with 4% paraformaldehyde in PBS (Santa Cruz Biotechnology, no. 30525-89-4) for 2 h and washed with 5% sucrose in PBS three times for 5 min. The eyecup was dehydrated with 20% sucrose in PBS, embedded in 20% sucrose in O.C.T. (1:2 volume ratio, Sakura, no. 4583), and then flash-frozen for cryosectioning at 10 μm thickness. For immunostaining, cryosections were first blocked with 5% normal donkey serum in 0.2% Triton X-100 in PBS, and then incubated with primary antibodies overnight at 4 °C. The S-opsin and M-opsin antibodies were identical to those used for retinal flatmount staining. Cone arrestin was probed with polyclonal rabbit anti-cone arrestin antibody (1:400; Millipore Sigma, no. AB15282). Cone sheaths were stained with fluorescein-conjugated peanut agglutinin (1:200; Vector Laboratories, no. FL-1071). Secondary antibodies were identical to those used for retinal flatmount staining. After incubation for 2 h at room temperature with secondary antibodies, cryosections were washed three times for 5 min each before mounting with a mounting medium containing DAPI (Vector Laboratories, no. H-1500-10) and securing with a coverslip.
Electroretinography
Scotopic ERG recording was performed as previously described15. Before photopic ERG recordings, mice were kept in a lighted vivarium. After induction of anesthesia, pupils were dilated with 1% tropicamide (Akorn, no. 17478-102-12), and bathed with 2.5% hypromellose (Akorn, no. 9050-1) to keep corneas hydrated. A mouse was placed on a heated Diagnosys Celeris rodent ERG device (Diagnosys LCC), and the ocular electrodes and ground electrode were placed on the corneas and hind leg, respectively. To measure M-cone and S-cone function, stimulation was performed with alternating green light and UV light at increasing intensities. Green light stimulation (peak emission 544 nm, bandwidth 160 nm) had intensity increments of −0.5, 0.5, 1.5, and 2.5 log cd·s/m2. UV light stimulation (peak emission 370 nm, bandwidth 50 nm) had intensity increments of −1, 0, 1, and 2 log cd·s/m2. The responses for 20–25 stimuli were averaged together, and the a- and b-wave responses were acquired from the averaged ERG waveform. The ERGs were analyzed with the Espion V6 software (Diagnosys LLC).
scRNA-seq analysis
Mice were euthanized, and eyes were enucleated for retinal tissue isolation. Retinal cells were dissociated using the Papain Dissociation System (Worthington Biochemical) following the manufacturer’s instructions and diluted to a final concentration of 1000 cells/µl. In each experimental group, four retinas were used for the mouse scRNA-seq. For each group, freshly dissociated cells (~16,500) were loaded into a 10× Genomics Chromium Single Cell system using v2 chemistry following the manufacturer’s instruction. Libraries were pooled and sequenced on Illumina NovaSeq6000 with ~500 million reads per library. Sequencing results were processed through the Cell Ranger 5.0.1 pipeline (10× Genomics) with default parameters. Seurat version 3.1 (90) was used to perform downstream analysis following the standard pipeline using cells with >200 genes and 1000 UMI counts, resulting in 4,240 WT mouse cells, 7482 untreated rd12 cells, and 5174 treated rd12 cells. Samples were aggregated, and cell clusters were annotated based on previous literature. UMAP dimension reduction was performed on the top principal components learned from high variance genes. Gene expression of each cell cluster was calculated using the average expression function of Seurat. Gene differential expressions of each cell type among different groups were performed using FindMarkers function with Wilcoxon test in Seurat.
Primary visual cortex (V1) electrophysiology
Mice were initially anesthetized with 2% isoflurane in a mixture of N2O/O2 (70%/30%) and then placed into a stereotaxic apparatus. A small, custom-made plastic chamber was glued to the exposed skull. One day after recovery, re-anesthetized animals were placed in a custom-made hammock, maintained under isoflurane anesthesia (1-2% in a mixture of N2O/O2) and four individual tungsten electrodes were inserted into a small craniotomy above the visual cortex of the right hemisphere. Once electrodes were inserted, the chamber was filled with sterile agar. During recording sessions, animals were sedated with chlorprothixene hydrochloride (1 mg/kg; IM) and kept under light isoflurane anesthesia (0.2–0.4%). EEG and EKG were monitored throughout the experiments and body temperature was maintained with a heating pad (Harvard Apparatus).
Data were acquired using a 32-channel Scout recording system (Ripple). The local field potential (LFP) from multiple locations was band-pass filtered from 0.1 to 250 Hz and stored together with spiking data on a computer with a 1 kHz sampling rate. The LFP signal was cut according to stimulus time stamps and averaged across trials for each recording location to calculate VEPs. The spike signal was band-pass filtered from 500 Hz to 7 kHz and stored in a computer hard drive at 30 kHz sampling frequency. Spikes were sorted online in Trellis (Ripple) while performing visual stimulation. Visual stimuli were generated in Matlab (Mathworks) using Psychophysics Toolbox and displayed on a gamma-corrected LCD monitor (55 inches, 60 Hz; 1920 × 1080 pixels; 52 cd/m2 mean luminance). Stimulus onset times were corrected for LCD monitor delay using a photodiode and microcontroller (in-house design).
For recordings of visually evoked responses, cells were first tested with 300 repetitions of a 500 msec bright flash stimulus (105 cd/m2). The background activity was calculated as average activity from 500 msec before stimulus onset for each repetition.
Analysis of V1 electrophysiology
The response amplitude of LFP was calculated as a difference between the peak of the positive and negative components in the VEP wave. The response latency was defined as the time point where maximum response occurred. The maximum of the response was defined as the maximum of either the negative or positive peaks. The single-unit responses to the flash stimulus were compared as the maximum response relative to stimulus onset. Average differences between animal groups were considered statistically significant at P ≤ 0.05 for two-tailed Mann–Whitney U-tests. Mean values given in the results include error bars for the standard error of the mean (SEM). All offline data analysis and statistics were performed in Matlab (Mathworks, USA).
Statistics and reproducibility
The statistical tests used for each experiment are stated in the corresponding figure captions. Statistical analysis was performed using the GraphPad Prism 9 and Microsoft Excel 2016 software. In vitro experiments were repeated independently at least three times with similar results, as shown in Supplementary Fig. 3a. The experiments in Figs. 1c, d, 5e, and 6e and Supplementary Fig. 5b, c were were performed in at least three biologically independent animals and similar results were observed.
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this article.
