Cell culture
The following cell lines were purchased from ATCC and cultured with the indicated medium. NCI-H1299 (ATCC® CRL-5803) (RPMI), HeLa (ATCC® CCL-2) (DMEM), A549 (ATCC® CCL-185)(F12K), MRC-5 (ATCC® CL-171)(EMEM), Hep3B (ATCC® HB-8064) (EMEM), Huh7 (DMEM), 293FT (Invitrogen R70007) (DMEM). RPMI, DMEM, F12K, and EMEM media were all purchased from Gibco (ThermoFisher Scientific, MA, USA) and supplemented with 10% fetal bovine serum (FBS) (GeminiBio CA, USA). Cells were maintained at 37 °C with 5% CO2 in a water jacket incubator. All cells were tested for mycoplasma contamination using MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza LT07-710, ME, USA) when thawed from frozen stocks and every 2 months after.
Plasmids
A complete list of plasmids and the specific cloning strategies used in this study can be found in Supplementary Table 1. All oligonucleotides, ultramers™, and gBlocks® were purchased from Integrated DNA Technologies (IDT; IA, USA). Preparation of DNA inserts was done through either PCR amplification or annealed oligo cloning. PCR amplification of genes was carried out using the indicated forward and reverse primers (Supplementary Table 1) using Q5 HiFi 2X master mix (NEB#M0492S; MA, USA). For site directed mutagenesis, two rounds of PCR were carried out following the procedures outlined in [61]. The resultant amplicons encoded overhangs for use in either restriction enzyme cloning or Gibson assembly as indicated in Supplementary Table 1. Annealed oligo cloning was carried out for generating the miRNA target site constructs. Briefly, ultramer™ oligonucleotides were phosphorylated using T4 PNK (NEB #M0201; MA, USA) according to the manufacturer’s instructions. Complementary ultramer™ strands were annealed at 75 °C for 10 min in a heat block and allowed to slowly cool to room temperature. Preparation of plasmid backbones or PCR products for assembly was carried out using the indicated restriction enzymes (Supplementary Table 1) according to the manufacturer’s instructions (NEB; MA, USA). Assembly of DNA fragments was carried out through either standard T4 ligation or Gibson assembly using T4 DNA ligase (NEB #M0202; MA, USA) or NEBuilder ® HiFi DNA Assembly Master mix (NEB #E2621; MA, USA) respectively, according to the manufacturer’s instructions. The miR-122 expression plasmid was obtained from addgene (Addgene#46673; MA, USA).
In vitro transcription (IVT) of mRNA
The NSs and GFP DNA templates were prepared for IVT by restriction enzyme digestion with MfeI and XhoI or XbaI (respectively) at cut sites upstream of the T7 transcriptional start site and downstream of the gene of interest stop codon. The digestion products were confirmed on an agarose gel and DNA purified using the Zymo DNA Clean and Concentrator kit (Zymo Research; CA, USA). One microgram of digested template was used in the HiScribe T7 Quick high yield RNA synthesis kit (#E2050; NEB; MA, USA). The transcribed RNA was DNase treated for 15 min at 37 °C and purified using an Invitrogen MegaClear™ kit (Invitrogen CA, USA). The molecular weight of the RNA product was confirmed by gel electrophoresis on a 1.8% agarose/1% bleach TAE gel [62]. The RNA was subsequently capped using the ScriptCap Cap1 Capping System and polyadenylated using the A-Plus Poly(A) Polymerase Tailing Kit according to the manufacturer instructions (CellScript, WI, USA). Successful incorporation of the ~200 nucleotide poly(A) tail was validated by gel electrophoresis. Capped and tailed RNA was treated with Antarctic Phosphatase to remove any remaining 5’ triphosphate groups that could potentially induce immune activation [63]. mRNA was aliquoted and stored at −80 °C until further use.
Transfection
Plasmid transfection was carried out using Lipofectamine™3000 (Invitrogen 11668019; CA, USA) according to the manufacturer’s guidelines. The mRNA transfection was carried out using Lipofectamine™ MessengerMAX™ (Invitrogen LMRNA001; CA, USA) according to the manufacturer’s guidelines. Cell seeding was performed as follows unless otherwise noted: 96 well:10,000, 24 well: 70,000, 12 well: 120,000, and 6 well: 350,000 cells. The amount of nucleic acid transfected and time points varied based on experiment and are noted in subsequent methods.
GFP and Luciferase co-transfections
To analyze the effect of NSs on either transcription or translation of a reporter gene co-transfection experiments were carried out. Seventy-thousand cells were seeded in a 24-well plate overnight and transfected with a master mix of lipofectamine™ 3000 and 75 ng of pcDNA3-GFP with approximately 25 ng of NSs, NSs mutant, or luciferase control mRNA. A total of 24 h after transfection cells were collected for flow cytometry and gene expression analysis. Cells collected for flow cytometry were washed twice with PBS and resuspended in 2% FBS-1X PBS. Ten thousand single cell events were collected using a BD C6 Accuri flow cytometer. Data were analyzed using FlowJo Version 10.7.1 (TreeStar; OR, USA). Processing of cells collected for gene expression analyses are described in the “Real-Time qPCR Analysis of Gene Expression” section below.
To analyze the effect of NSs on translation, co-transfection with luciferase mRNA and NSs was performed. Seventy-thousand cells were seeded in a 24-well plate overnight. A transfection master mix of Lipofectamine™ MessengerMAX™ and with 25 ng of luciferase mRNA was prepared to ensure an equivalent amount of luciferase reporter in each condition. This master mix was subsequently incubated with NSs, NSs mutant, or GFP mRNA and added to cells. A 1:1 ratio of reporter: experimental mRNA was used in this experiment because luciferase activity is very sensitive and does not require high input for detection. Media was removed 24 h post-transfection and 100 µl of Glo-Lysis buffer (Promega E2661; WI, USA) was added and placed on a rocker for 5 min. One hundred microliters of lysate was transferred to a white bottom 96-well plate and 100 µl of Bright-Glo reagent (Promega E2610; Madison, WI, USA) was added to each well. Luminescence was measured on a GloMax® Explorer microplate reader (Promega; WI, USA). Relative luminescence was determined by normalizing to the control mRNA sample.
Dual luciferase assays
To evaluate the endogenous levels of miR-122 expression, 70,000 cells were seeded in a 24-well plate and transfected with 400 ng of psiCHECK2.1 control or psiCHECK2.1 miR-122 using Lipofectamine™ 3000 and a Dual-Luciferase® Reporter assay was carried out according to the manufacturer’s guidelines (Promega E1910; WI, USA). Luminescence was measured on a GloMax Explorer microplate reader (Promega; WI, USA). Data were processed by dividing Rluc/FLuc values and normalized to the psiCHECK control treated cells.
Viability assays
To assess cell viability, alamarBlue assays were performed. Briefly, 10,000 cells were seeded in a 96-well plate overnight, transfected with an escalating dose of mRNA ranging from 0.625 to 5 ng using Lipofectamine™ MessengerMAX™, and processed at 48 h post-transfection. The alamarBlue assay uses the non-toxic and cell permeable compound resazurin to measure proliferation in cell culture. Resazurin is a colorimetric oxidation-reduction indicator that changes from blue to pink in the presence of metabolically active cells [64]. A 10X Alamar reagent was prepared by mixing 650 µM rezasurin (Sigma Aldrich® 199303, MO, USA), 1 mM potassium ferrocyanide (ACROS Organics™ 196781000, MA USA), 1 mM potassium ferricyanide (ACROS Organics™ 424130050), and 78 µM methylene blue (Sigma Aldrich® M9140) in DPBS (U.S. Pat. No. 5501959). For the assay, the alamar reagent was diluted to 1X in cell culture media and plates were placed on an orbital shaker for 2 min. Plates were subsequently incubated at 37 °C and 5% CO2 for 1–2 h. Fluorescence was measured at 520 and 590 nm using the GloMax® Explorer microplate reader (Promega; WI, USA). Blank media values were subtracted from all samples and mock treated cells were used as reference for 100% viability. For multi-day proliferation analysis in Fig. 1C, 5 ng of the indicated mRNAs were transfected into cells seeded in a 96-well plate and alamarBlue readings were done at 24-, 48-, and 72 h post-transfection.
Bright-field microscopy
In order to capture the visible toxicity, brightfield microscopy images were captured on the ZEISS Axio Vert A1 inverted microscope (ZEISS; Oberkochen, Germany) and processed using ZEN Blue v2.6 software (ZEISS; Oberkochen, Germany). Microscopy images were taken in cells transfected for viability assays described above.
Cytotoxicity
In order to evaluate cytotoxicity and loss of membrane integrity we performed a CytoTox96 assay (Promega #G1780; WI, USA). Ten-thousand cells were seeded in a 96-well plate overnight, transfected with 10 ng of mRNA using Lipofectamine™ MessengerMAX™, and incubated for 48 h. Prior to beginning the assay, lysis solution (Promega #G1821; WI, USA) at 1X concentration was added to cells for 45 min to serve as a positive control for LDH release. At 48 h post transfection, 50 µl of cell culture media was removed from cells and transferred to a white bottom 96-well plate. Fifty microliters of CytoTox96 reagent was added per well and the plate was rocked gently for 30 min at room temperature. Following incubation, stop solution was added and absorbance was measured at 490 nm using the GloMax Explorer microplate reader (Promega; WI, USA).
Annexin V/propidium iodide apoptosis analysis
To assess the number of cells undergoing apoptosis or necrosis as a result of NSs, Annexin V and propidium iodide analysis was carried out as described previously [65]. One-hundred thousand cells were seeded in a 12 well plate overnight and transfected with 225 ng of NSs, NSs mutant, or luciferase mRNA using Lipofectamine™MessengerMAX™. And, 24 h post-transfection, cells were gently lifted from the plate using Accutase and were subsequently washed twice with cold 1X PBS. Cells were resuspended in 98 µl of annexin binding buffer, 1 µl of AnnexinV FITC (BD Biosciences Pharmingen; CA, USA), and 1 µl of 1 mg/ml Propidium Iodide (Sigma-Aldrich; MO, USA) and incubated at room temperature for 15 min. An additional 200 µl of annexin binding buffer was added to samples prior to flow cytometry analysis. Ten thousand single cell events were collected using a BD C6 Accuri flow cytometer (BD Biosciences Pharmingen; CA, USA), and the data were analyzed using FlowJo Version 10.7.1 (TreeStar; OR, USA).
Caspase 3/7 assay
Approximately 10,000 cells were seeded into clear bottom white-walled 96 well plates overnight (Thermo Scientific™ #165306; IL, USA) and were transfected with 0.625, 1.25, or 2.5 ng of NSs, NSs Mutant, or GFP mRNA using Lipofectamine™ MessengerMAX™. At 24 h post-transfection, 100 µl of Caspase 3/7 reagent (Promega G8090; WI, USA) was added to each well and the plate gently rocked for 30 s. Plates were incubated at room temperature for 1 h before detecting luminescence using the GloMax Explorer microplate reader (Promega; WI, USA).
Western blotting
Approximately 350,000 cells were seeded in a 6-well plate overnight and transfected with approximately 175 ng of mRNA using Lipofectamine™ MessengerMAX™. At 24 h post-transfection, cells were collected and washed once with 1X PBS. Cells were lysed using RIPA buffer (10 mM Tris-HCl pH 8, 1 mM EDTA, 0.5 mM EGTA, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1% SDS, 140 mM NaCl) with 1X Halt protease inhibitor (ThermoFisher Scientific,MA, USA) and sonicated (10 s on 30 s off for 3 rounds) using a Bioruptor 300 (Diagenode; NJ, USA). Soluble protein extract was clarified by high speed centrifugation to pellet debris, and protein concentration was then determined using a BCA Assay kit (PierceTM; ThermoFisher Scientific,MA, USA). Proteins were denatured in 1X Laemmli buffer for 95 °C for 10 min and were electrophoresed on a 4-20% Mini-PROTEAN TGX gel (Bio-Rad; CA, USA) for 25 min at 40 V and then 55 min at 100 V. Thereafter, gels were transferred to nitrocellulose membranes using a semi-dry transfer system (TubroBlot, Bio-Rad; CA, USA), and blocked for 1 h with 3% bovine serum albumin (BSA) dissolved inTBST. Blots were incubated overnight with agitation at 4 °C with a primary antibody solution. The following antibodies were used: M2 FLAG antibody (F3165, Sigma-Aldrich; MO, USA), p53 (sc-126, Santa Cruz Biotechnology; TX, USA), H2AX (2595, Cell Signaling Technologies; MA, USA), ɣH2AX (2577, Cell Signaling Technologies; MA, USA), H3 (4499 S, Cell Signaling Technologies; MA, USA), TFIIH p62 antibody (PA529379, Invitrogen; CA, USA), Alpha Tubulin (ab4074, Abcam; Cambridge, United Kingdom), and GAPDH (sc-47724, Santa Cruz Biotechnology; TX, USA). Thereafter, blots were washed 3X with TBST and incubated for 1 h with a secondary antibody solution. The following secondary antibodies were used: anti-mouse IgG HRP conjugate (1706516, Bio-Rad; CA, USA), anti-rabbit IgG HRP conjugate (1706515, Bio-Rad; CA, USA). Blots were washed as described and were subsequently developed using Pierce ECL2 chemiluminescent reagent (ThermoFisher Scientific; MA, USA) and ChemiDoc Touch imaging system (Bio-Rad; CA, USA). Images were captured based on auto exposure determination within the ChemiDoc Touch system. Images were analyzed and exported to TIFF using Image Lab version 6.1 (Bio-Rad; CA, USA).
Real-time qPCR analysis of gene expression
To assess changes in gene expression in NSs-treated cells, qPCR analysis was carried out. RNA was isolated using the Maxwell RSC purification kit (Promega; WI, USA), and 10 ng of total RNA was reverse transcribed and amplified using Luna® Universal One-Step RT-qPCR master mix (NEB; MA, USA) in the LightCycler96 real-time PCR system (Roche; Basel, Switzerland). Cycling conditions were as follows: reverse transcription (55 °C for 10 min) and initial denaturation (95 °C for 1 min) followed by 40 cycles of denaturation (95 °C for 10 s) and extension (60 °C for 30 s, with plate read). The fold change in gene expression was determined using the 2-ΔΔCt method. The following qPCR primers were purchased from IDT (Integrated DNA Technology; IA, USA): B2M Fwd: 5’ TAGAGGTGGGGAGCAGAGAA, B2M Rev: 5’ TCCCCCAAATTCTAAGCAGA, GFP Fwd: 5’GACAACCACTACCTGAGCAC, GFP Rev: 5’CAGGACCATGTGATCGCG.
Microscopy visualization of poly(A) mRNAs
The following methods were adjusted from Copeland et., al 2015 and Kumar and Glausinger 2010 [35, 50]. To visualize the localization of poly(A) mRNAs in NSs treated cells, approximately 27,000 H1299 cells were seeded on poly-L lysine treated cell culture slides (Biologix; MO, USA). After seeding, cells were transfected with 6.75 ng of either NSs or luciferase mRNA using Lipofectamine™ MessengerMAX™. At 24 h post transfection cells were washed once with 1X PBS and then fixed using 4% PFA for 10 min. Cells were permeabilized using ice cold 100% methanol for 5 min and placed in 70% ethanol for 10 min. Cells were washed twice in 1X PBS and incubated in 1 M Tris pH 8 for 5 min. Cells were subsequently incubated for 15 min at 37 °C in prewarmed hybridization solution [10 µg/mL yeast tRNA (Invitrogen; CA, USA), 10% wt/vol dextran sulfate (Alfa Aesar;MA, USA), 25% vol/vol formamide, 200U of RNAse Out (Invitrogen; CA, USA), and 2X SSC (Sigma-Aldrich; Munich, Germany)]. 5 ng/µL of a Cy3 labeled oligo(dT)35 (Integrated DNA Technology; IA, USA) was prepared in the hybridization solution, applied to cells and incubated overnight at 37 °C in the dark. Cells were washed twice with prewarmed 2X SSC, followed by two washes with 0.5x SSC, and incubated in 4% PFA for 10 min. Cells were washed three times with 1X PBS. In order to probe for other intracellular proteins, the slides were blocked using 2% BSA in PBS for 1 h at room temperature. Primary fluorescent antibodies were diluted 1:200 in 0.1% BSA and incubated overnight at 4 °C protected from light. Cells were washed three times with 1X PBS and allowed to air dry. Slides were mounted using Prolong Diamond antifade mountant with DAPI (Molecular Probes; OR, USA) and allowed to set overnight at 4 °C. Slides were imaged using Zeiss Observer Z1 microscope (Zeiss; Oberkochen, Germany). Images were processed using ZEN 2.6 (blue edition) (Zeiss; Oberkochen, Germany).
Statistical analysis
All data are presented as mean ± S.D. or S.E.M. (unless otherwise noted) and are representative of a minimum of two independent experiments. When appropriate, data were analyzed using two-way ANOVA to compare two or more independent variables. Two-way ANOVA tests were corrected using the Tukey method. P-value < 0.05 was considered to be statistically significant. Data were graphed and statistical analyses were performed using Graphpad Prism (version 8.4.3).
