Ethical regulation
All animal experimental procedures were approved by the Animal Experiment Committee of Tokyo Medical and Dental University (A2021-172C2).
Reagents, cells, and mice
Acetic anhydride was purchased from Kanto Chemicals. Acetonitrile, N,N’-dimethylformamide (DMF), Et2O, N-methyl-2-pyrrolidone (NMP), piperidine, and trifluoroacetic acid (TFA) were purchased from Kishida Chemical (Tokyo, Japan). N,N-Diisopropylethylamine (DIEA) was purchased from Nacalai Tesque (Kyoto, Japan). TNBS Test Kit, triisopropylsilane (TIS), 5-ethynyl-2’-deoxyuridine (EdU), and 4-pentynoic acid were purchased from Tokyo Chemical Industry (Tokyo, Japan). Fmoc-Ala-OH•H2O, Fmoc-Arg(Pbf)-OH, Fmoc-Asp(OtBu)-OH, Fmoc-Gln(Trt)-OH, Fmoc-Glu(OtBu)-OH H2O, Fmoc-Ile-OH, Fmoc-Lys(Boc)-OH, Fmoc-Met-OH, Fmoc-Thr(tBu)-OH, Fmoc-Trp(Boc)-OH, Fmoc-Tyr(tBu)-OH, Fmoc-Val-OH, Fmoc-NH-SAL Resin, 1-[bis(dimethylamino)methylene]-1H-benzotriazolium 3-oxide hexafluorophosphate (HBTU), and 1,2,3-benzotriazol-1-ol monohydrate (HOBt•H2O) were purchased from Watanabe Chemical Industries (Hiroshima, Japan). Ultrapure water for HPLC (filtered through a 0.22 μm membrane filter, >18.2 MΩ cm) was purified in Purelab DV35 of ELGA (Buckinghamshire, UK). Nhe I, Not I, and Xho I were purchased from New England Biolabs (MA, U.S.A.). 4’,6-Diamidino-2-phenylindole (DAPI) and bovine serum albumin (BSA) were purchased from Sigma (MO, U.S.A.). cOmplete EDTA-free was purchased from Roche (Upper Bavaria, Germany). Dulbecco’s Modified Eagle Medium (DMEM, high glucose), Medium 199, fetal bovine serum (FBS), penicillin-streptomycin, GlutaMAX, 1-Step Ultra TMB-ELISA Substrate Solution, Alexa Fluor 647 Azide Triethylammonium Salt, and Alexa Fluor-conjugated secondary antibodies were purchased from Thermo Fisher Scientific (MA, U.S.A). Type I collagen and a mouse anti-NeuN antibody (MAB377) were purchased from Merck (Darmstadt, Germany). TransIT-LT1 Transfection Reagent, Endothelial Cell Growth Medium 2 (ECGM2), HUVECs were purchased from TaKaRa (Shiga, Japan). A chicken anti-GFP antibody (ab19370), a rabbit anti-GFP antibody (ab290), and a rabbit anti-laminin (ab11575) were purchased from Abcam (Cambridge, U.K.). An anti-mouse VEGF antibody (AF-493-NA), biotinylated anti-mouse VEGF (BAF493), and mouse recombinant VEGF (493-MV) were purchased from R&D Systems (MN, U.S.A.). VECTASTAIN Elite ABC Standard Kit, recombinant GFP (MB-0752), and DyLight 488 Conjugated Lycopersicon esculentum Lectin (488-LEL) were purchased from Vector Laboratories (CA, U.S.A.). Biotinylated goat anti-rabbit IgG (111-065-003) was purchased from Jackson ImmunoResearch (PA, U.S.A.). Fluoro-Jada C Ready-to-Dilute Staining Kit was purchased from Biosensis (Thebarton, Australia). 293 T cells (RCB2202) were provided by the RIKEN BRC through the National Bio Resource Project of the MEXT/AMED Japan. C57BL/6 J mice were purchased from Charles River Laboratory Japan (Kanagawa, Japan).
Peptide synthesis
Peptides were synthesized by Fmoc solid-phase peptide synthesis. A condensation-reagents cocktail of HBTU (3.05 g, 8.04 mmol) and HOBt•H2O (1.25 g, 8.16 mmol) in DMF (16 mL), a mixture of DIEA (2.75 mL) and NMP (14.25 mL), and a cleavage cocktail of TIS (62.5 μL), TFA (2.375 mL), and water (62.5 μL) were prepared just prior to the synthesis. Fmoc-NH-SAL Resin (0.10 mmol) in a polypropylene tube, LibraTube of HiPep Laboratories (Kyoto, Japan) was soaked in DMF (2 mL) over 3 h at 25 °C. After removal of DMF, piperidine in DMF (20%, 2 mL) was added and mixed with a vortex device for 1 min. After the reaction solution was removed, piperidine in DMF (20%, 2 mL) was added and the reaction tube was shaken for 10 min at 25 °C on a PetiSyzer of Hipep Laboratories. After removal of the reaction solution, the resin was washed with DMF (2 mL, 5 times), CH2Cl2 (2 mL, 3 times) and DMF (2 mL, 3 times). To the resin was added Fmoc-protected amino acid (0.30 mmol) dissolved in the condensation-reagents cocktail (700 μL) and the mixture of DIEA and NMP (700 μL). After shaking for 20 min at 25 °C, the reaction solution was removed and the resin was washed with DMF (2 mL, 5 times), CH2Cl2 (2 mL, 3 times) and DMF (2 mL, 3 times). The Fmoc deprotection reactions with piperidine and coupling reactions of Fmoc-protected amino acid were repeated following the designed sequence. After the final Fmoc deprotection reaction and washing, to the resin was added acetic anhydride in CH2Cl2 (25%, 2 mL) and the reaction tube was shaken for 10 min at 25 °C. After removal of the reaction solution, the resin was washed with CH2Cl2 (2 mL, 3 times), DMF (2 mL, 5 times), CH2Cl2 (2 mL, 5 times) and CH3OH (2 mL, 5 times). To the resin was added the cleavage cocktail (2.5 mL) and the reaction tube was left to stand for 90 min at 25 °C with gentle shaking every 30 min. The solution was collected into a polypropylene centrifuge tube by filtration. The reaction tube was rinsed with TFA (500 μL, 3 times), which is also collected by filtration. To the centrifuge tube was added Et2O (40 mL) and the tube was mixed on a vortex device for 1 min and centrifuged at 4 °C (3500 × g, 5 min) on a micro refrigerated centrifuge Model 3700 of Kubota (Tokyo, Japan), followed by removal of the supernatant liquid. After repeating this process for 3 times, the peptide was dried under vacuum over 2 h at 25 °C, dispersed in water and lyophilized by FDU-1200 of EYELA (Tokyo, Japan) attached with GLD-051 oil rotary vacuum pump of ULVAC (Tokyo, Japan). The synthesized peptides were purified by semi-preparative high performance liquid chromatography (HPLC) performed on PU-4086-Binary pump, UV-4075 detector and CHF122SC fraction collector of JASCO (Tokyo, Japan) attached with TA12S05-2520WX Actus Triart column (20 mmφ × 250 mm) of YMC (Tokyo, Japan) with a flow rate of 18.9 mL min–1. Gradient profile of the semi-preparative HPLC: water/acetonitrile = 90/10 (0 to 10 min), 40/60 (30 min), linear gradient between 10 and 30 min. Successful isolation of the peptides was checked by analytical HPLC performed on PU-4180-pump and UV-4075 detector JASCO (Tokyo, Japan) attached with TA12S05-2546WT Triart C18 column (4.6 mmφ × 250 mm) of YMC (Tokyo, Japan) with a flow rate of 1.0 mL min–1. Gradient profile of the semi-preparative HPLC: water/acetonitrile = 90/10 (0 to 5 min), 40/60 (30 min), linear gradient between 10 and 30 min (Supplementary Fig. 33). The synthesized peptides were characterized with matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) performed on autoflex speed spectrometer of Bruker (Bremen, Germany) in a reflector positive mode with 2,5-dihydroxybenzoic acid as a matrix (Supplementary Fig. 34). The collected samples were lyophilized and stored at –20 °C or –80 °C.
MALDI-TOF MS (2,5-dihydroxybenzoic acid, reflector positive,): m/z calculated for Ac-RIDARMRADIR-NH2 + H+ ([JigSAP + H]+, C57H105N24O16S+): 1413.786, found: 1413.782; m/z calculated for Ac-RVDVRVRVDVR-NH2 + H+ ([5 V + H]+, C57H105N24O16S+): 1409.845, found: 1409.866; HC ≡ CCH2CH2C( = O)-RIDARMRADIR-NH2 + H+ ([Alkyne-JigSAP + H]+, C60H107N24O16S+): 1451.802, found: 1451.838; Ac-KLTWQELYQLKYKGIRIDARMRADIR-NH2 + H+ ([QK-JigSAP + H]+, C149H246N45O38S+): calculated 3305.842, found: 3305.670.
Gelation procedure
A lyophilized sample after HPLC purification was dissolved in water. Addition of 100 mM NaOH aq. to the aqueous solution (pH ~ 11) afforded precipitates. The precipitates were collected by centrifugation at 4 °C (3500 × g, 5 min) on a micro refrigerated centrifuge Model 3700 of Kubota, dissolved in water again, and lyophilized by FDU-1200 of EYELA attached with GLD-051 oil rotary vacuum pump of ULVAC. The obtained lyophilized peptide powder (2.5 mg) was dissolved in 247.5 μL DMEM buffer containing 4.0 mM HEPES and 1× penicillin (pH 7.4) and incubated at 37 °C under 5% CO2 for 24 h. For incorporation and sustained release, and HUVEC tube assay, the lyophilized peptide powder (1.0 mg) was dissolved in 50 μL DMEM buffer and mixed with 50 μL of peptide-tagged protein (45.5 ng for EGFP and 40.0 ng for VEGF) in DMEM buffer. After 24 h, these assays were performed. For in vivo injection, these conjugates were immediately injected into the brain after the mixture.
Computational details
All-atom molecular dynamics (MD) simulations were carried out by using GROMACS 2016.6. For each system, 90 peptide and about 38,000 water molecules and 180 chloride ions were randomly inserted in the initial cubic simulation box with sides of length 11 nm by referring to the previous study27. The relaxation runs at 250 K and 310 K for 2 ns under the periodic boundary conditions were successively carried out after the steepest descent energy minimization. After the relaxation runs, the equilibration MD runs were performed at 1 bar and 310 K for 300 ns under the periodic boundary conditions. The Amber ff99SB-ILDN force field46 was used for the force field parameters of the peptides and ions and the TIP4P-EW model was used for the water molecules. During the relaxation runs, carbon, nitrogen, oxygen, and sulfur atoms of the peptides were restrained to their initial position with a force constant of 1,000 kJ·mol–1·nm–2. The velocity-rescaling47 and Berendsen barostat48 were used to keep the temperature and pressure of the system with relaxation times of 0.2 and 2.0 ps, respectively. The equilibration runs were performed using the Nosé-Hoover thermostat49,50,51 and Parrinello-Rahman barostat52 with relaxation times of 1.0 and 5.0 ps. The all-bonds connected to hydrogen atoms were constrained with the LINCS algorithm53 and the time step was set to 2 fs. The smooth particle-mesh Ewald method54 was used to calculate the long-range Coulomb interactions. The real space cutoff and the grid spacing are 1.4 and 0.30 nm, respectively.
Rheology measurements
Rheology measurements were conducted with rotational rheometer Kinexus lab+ of Malvern Panalytical (Malvern, UK) attached with Peltier plate cartridge and 20 mmφ convex plate and 20 mmφ parallel plate geometries (PU20 and PLS20). 250 μL of a sample was loaded and sandwiched by the plates with a gap of 0.2 mm. Storage and loss moduli (G’ and G”) were obtained by amplitude sweep measurements at 1.0 Hz at strains from 0.1 to 1000% at 20 °C. G’ and G” were taken at plateau values in the linear viscoelastic region. Replication of the rheological data was confirmed by measuring independently-prepared three samples, which showed essentially identical profiles (Supplementary Fig. 35). The data generated in this study are provided in the Source Data.
Circular dichroism (CD) spectrometric measurements
CD spectra were recorded on J-1100 CD spectrometer of JASCO (Tokyo, Japan) with PTC-514 peltier temperature controller. 150 μL of a sample was loaded into a quartz assembly cell AB20-UV-0.1 of GL Sciences (Tokyo, Japan) with 0.10-mm optical path length. The data generated in this study are provided in the Source Data.
Infrared (IR) spectroscopic measurements
IR absorption spectra were recorded using an FT/IR–6100 Fourier transform infrared spectrometer of JASCO (Tokyo, Japan). 15 µL of a hydrated sample was loaded into a CaF2 cell with 10-µm optical path length (Biocell, Biotools, FL, USA). Each spectrum was measured with 512-times accumulation at a spectral resolution of 4 cm–1. The data generated in this study are provided in the Source Data.
Fluorescence spectroscopic measurements
Fluorescence spectra were recorded using RF-6000 spectrometer of Shimadzu (Kyoto, Japan). 200 μL of a solution or gel sample was loaded into a quartz cell with 10-mm optical path length (18-F/Q/10, Starna Scientific, Hainault Essex, UK). Fluorescence spectra of samples containing EGFP were measured upon excitation at 488 nm. Fluorescence spectral measurements for evaluation of the critical aggregation concentrations were performed with samples containing 25 μM thioflavin T (ThT) upon excitation at 440 nm, and the fluorescence intensities at 480 nm were used for the analyses. The data generated in this study are provided in the Source Data.
Transmission electron micrographic (TEM) observations
TEM observations were conducted with H-7600 of Hitachi (Tokyo, Japan) under 100 kV accelerating voltage. A peptide sample (1.0 wt%) dispersed in aqueous NaHCO3 (8.8 wt%) solution was diluted with distilled water by 10 times prior to the observation. 5 μL of a sample was placed on a parafilm. Then, a carbon coated 400 mesh copper grid was positioned on top of the drop for 10 s and washed by a droplet of distilled water. For staining, a drop of 2 wt% uranyl acetate was placed on parafilm and the grid was positioned on top of the drop for 10 s. Excess liquid was gently removed using an absorbing paper. After air drying, the grid was submitted to TEM observation.
Small-angle X-ray scattering (SAXS) measurements
SAXS measurements were carried out with NANO-Viewer system (Rigaku, Tokyo, Japan) equipped with Dectris (Baden-Daettwil, Switzerland) PILATUS 100k detector (CuKα, λ = 1.5418 Å) and NANOPIX system (Rigaku, Tokyo, Japan) equipped with Rigaku HyPix-6000 detector (CuKα, λ = 1.5418 Å) using a glass capillary with a diameter of 2.5 mm. X-ray beam diameter: 0.8 mm (NANO-Viewer) and 0.6 mm (NANOPIX), irradiation time: 15 min (NANO-Viewer) and 30 min (NANOPIX), camera length: 703.75 mm (NANO-Viewer) and 1348.75 mm (NANOPIX), measurement range (2θ): 0 to 4 degree (NANO-Viewer) and 0 to 3.5 degree (NANOPIX), standard sample: Ag Behenate.
Confocal laser scanning microscopy (CLSM) observations
CLSM was performed on a Leica type TCS SP8 microscope, where micrographs were recorded upon excitation at 552 nm to observe fluorescence images at 565 − 620 nm under identical settings for comparison.
Cell adhesion assay
The dried peptides dissolved in DMEM medium (1.0% w/v, 50 µL) were sonicated using Bioruptor (UCW-310; Cosmo Bio, Tokyo, Japan) and put on a chamber slide (Millizell EZ 8-well glass; Merck, Darmstadt, Germany). After vacuum-dried (VC-96W; TAITEC, Aichi, Japan), the peptide-coated cover-glasses were rinsed with PBS one time. NIH 3T3 fibroblasts (3.6 × 105 cells for 30 min culture and 3.6 × 104 cells for 24 h culture) were suspended in DMEM medium including 10 % FBS, plated on the peptide-coated cover-glasses, and incubated in a 5% CO2 incubator. After 30 min and 24 h, cells were gently washed with PBS one time and fixed with 4% paraformaldehyde for 15 min at 25 °C. The fixed cells were washed with PBS including 0.5% Triton X-100 three times and stained with Alexa Fluor 594 Phalloidin for 30 min, and DAPI (2.0 µg/mL) for 10 min. Fluorescence micrographs were captured using a fluorescence microscope. The DAPI-positive nuclei were counted by unbiased 2D stereology (Stereo Investigator, MBF Bioscience, VT, U.S.A.). The data generated in this study are provided in the Source Data.
Fusion protein
To generate pCAG-EGFP-Histag, the EGFP cDNA attached with Nhe I and Not I sites was amplified from pCAG-GFP plasmid55 with the following primes 5’-TTGCTAGCATGGTGAGCAAGGGCGAGGA-3’ and 5’-TTGCGGCCGCCTTGTACAGCTCGTCCATG-3’. The amplicon was then inserted into the Nhe I/Not I sites of pCAG-CST-Histag56. To generate pCAG-EGFP-Histag-RADA16, the 6×Histag-RADA16 cDNA attached Not I and Xho I sites was generated by annealing the following oligo DNAs (5’-GGCCCATCATCATCATCATCATCGAGCAGACGCCCGTGCGGATGCTAGAGCGGACGCCAGAGCAGATGCTTAA-3’ and TCGAGTTAAGCATCTGCTCTGGCGTCCGCTCTAGCATCCGCACGGGCGTCTGCTCGATGATGATGATGATGATG-3’) and then inserted into the Not I/Xho I sites of pCAG-EGFP-Histag. To generate pCAG-EGFP-Histag-IAMAI and pCAG-EGFP-Histag-5V, the fusion protein cDNAs attached with Nhe I and Xho I sites were amplified by PCR from pCAG-EGFP-Histag with the following primers 5’-TTGTCCCAAATCTGTGCGGAGCC-3’ and 5’-TTGAGCTCTTACCGTATATCTGCTCGCATTCTTGCGTCGATACGATGATGATGATGATGATGTGCGGC-3’ for IAMAI and 5’-GGAGCCGAAATCTGGGAG-3’ and 5’-TGCTCGAGTTACCGTACATCAACTCGAACTCTTACGTCCACACGATGATGATGATGATGATGTGCGGC for 5 V. The amplicon was then inserted into the Nhe I/Xho I site of pCAG-EGFP-Histag. To generate pCAG-VEGF-Histag-IAMAI, the fusion protein cDNAs attached with Nhe I and Xho I sites were amplified by PCR from pCAG-VEGF-Histag56 with the following primers 5’-TTGTCCCAAATCTGTGCGGAGCC-3’ and 5’-TTGAGCTCTTACCGTATATCTGCTCGCATTCTTGCGTCGATACGATGATGATGATGATGATGTGCGGC-3’. The amplicon was then inserted into the Nhe I/Xho I site of pCAG-VEGF-Histag. To obtain genetically engineered proteins, 293 T cells (5.2 × 105 cells) were plated in 6-well plates in 2.5 mL of DMEM with 10% FBS. One day later, the cells were transiently transfected with pCAG-EGFP-Histag, pCAG-EGFP-Histag-RADA16, pCAG-EGFP-Histag-IAMAI, pCAG-VEGF-Histag, or pCAG-VEGF-Histag-IAMAI using TransIT-LT1 Transfection Reagent according to the manufacturer’s instructions. To obtain Histidine-tagged VEGF and VEGF-JigSAP, the conditioned medium was collected at 7 days after transfection, passed through a 0.45-µm filter, concentrated by an ultrafiltration column (Amicon Ultra 10 K; Merck, Darmstadt, Germany), displaced in the fusion protein buffer [137 mM NaCl, 2.70 mM KCl, 0.810 mM Na2HPO4, 0.147 mM KH2PO4 (pH7.4)], and kept at −80 °C before use. To obtain Histidine-tagged EGFP, EGFP-RADA16, EGFP-JigSAP, and EGFP-5V, the transfected 293 T cells were lysed in lysis buffer [20 mM Tris (pH 7.4), 150 mM NaCl, 1 mM ethylene-diamine-tetra-acetic acid (EDTA), 1% NP-40, and protease inhibitor (cOmplete EDTA-free)], and the samples were centrifuged at 15,000 ×g for 5 min. The soluble fraction was concentrated by an ultrafiltration column (Amicon Ultra 10 K, Merck), displaced in the fusion protein buffer, and kept at −80 °C before use. For rheology measurements and SAXS profiles experiments, we used the E. coli expression system to obtain EGFP-JigSAP and EGFP-RADA16 because a high amount of EGFP-JigSAP and EGFP-RADA16 were required. EGFP-Histag-IAMAI and EGFP-Histag-RADA16 were inserted into the Xho I/Eco RI site of pRSETb vector (V35120, Thermo Fisher Scientific). Recombinant proteins were produced in E. coli (JM109 DE3). After the freeze-thaw cycles of the E. coli, the lysates were applied to NI-NTA agarose column (30210, QIAGEN). EGFP-JigSAP and EGFP-RADA16 were eluted with 200 mM imidazole, and the buffer was replaced with PBS by ultrafiltration.
ELISA
EGFP and VEGF quantification was done by sandwich ELISA. A chicken anti-GFP antibody (1:5000) or an anti-mouse VEGF antibody (1:1000) was incubated in a 96-well plate at 4 °C overnight. After washing the plates with TBS with 0.05% Tween 20 (TBS-Tw) and blocking the plates with 1% BSA in TBS-Tw, the proteins diluted with 1%BSA in TBS-Tw were incubated for 1 h. After washing, a rabbit anti-GFP antibody (1:5000) and biotinylated anti-mouse VEGF (1:1000) was added. The plates were incubated for 1 h, stained with VECTASTAIN Elite ABC Standard Kit, and visualized by 1-Step Ultra TMB-ELISA Substrate Solution. For EGFP quantification, biotinylated goat anti-rabbit IgG (1:500) was used after secondary antibody reaction. OD 600 was measured by ChroMate (Asahi Techneion, Tokyo, Japan). EGFP and VEGF were quantified using recombinant GFP and mouse recombinant VEGF, respectively as a standard.
Incorporation assay
Incorporation of the genetically engineered proteins into the self-assembling peptides was evaluated as follows. 50 µL of 2% JigSAP, 5 V, or RADA16 solution was mixed with 50 µL of Histidine-tagged EGFP-JigSAP (45.5 ng), EGFP-5V (45.5 ng), EGFP-RADA16 (45.5 ng), VEGF-JigSAP (40.0 ng), EGFP (45.5 ng), or VEGF (40.0 ng) in DMEM medium. After incubating them at 37 °C in a CO2 incubator for 24 h, the hydrogels were washed with 250 µL of PBS. The concentration of EGFP and VEGF in the soluble fraction was measured by ELISA. EGFP and VEGF incorporation were calculated by the following formula. Protein incorporation (%) = [(weight of input) – (weight of the soluble fraction)] / (weight of input) × 100 (%). The data generated in this study are provided in the Source Data.
Sustained-release assay
JigSAP, 5 V, or RADA16 peptide hydrogels incorporated with full-length protein as described above were washes with PBS 3 times and incubated with 200 µL of 10% FBS in PBS at 37 °C and 500 rpm (CM-1000; EYELA, Tokyo, Japan). After 6, 12, 24, 72, 96, and 168 h, the soluble fractions were collected and then incubated with 200 µL of 10% FBS in PBS. EGFP or VEGF release was calculated by the following formula. Released protein / incorporated protein (%) = (total weight of the soluble fraction) / (weight of incorporated protein) × 100 (%). The data generated in this study are provided in the Source Data.
HUVEC tube formation assay
JigSAP and collagen gels (400 µL) were formed in 24-well plate (37 °C, 5% CO2) for 1 h by mixing gelation medium [26.5 mM NaHCO3, 0.2 mM GlutaMAX, 2.7 mg/mL type I collagen, and 6.2 mM NaOH in Medium-199 with or without 0.1% JigSAP and 200 ng/mL VEGF-JigSAP. HUVECs (1.2 × 107 cells/mm2) (D10008; TaKaRa) suspended in ECGM2 medium were seeded on collagen gel and incubated (37 °C, 5% CO2) for 1 h. After removing the medium, JigSAP and collagen gels (400 µL) were covered on HUVECs. After 1 h (37 °C, 5% CO2), ECGM2 medium (800 µL) supplemented with 10% FBS with or without 200 ng/mL soluble VEGF-JigSAP was added. After 3 days (37 °C, 5% CO2), the cultured HUVECs with gels were fixed with 4% PFA. The gels were dissected with surgical knife to expose HUVECs on the surface of the gels and then incubated with 488-LEL (1:1000) in PBS with 0.5% Triton X-100 (PBS-Tx) for 1 h to visualize endothelial cells. The nuclei were counterstained with 2 µg/mL DAPI. The images were captured using a microscope (IX73; Olympus, Tokyo, Japan) and a CCD camera (C10600-10B; Hamamatsu Photonics, Shizuoka, Japan). The data generated in this study are provided in the Source Data.
Mouse ischemic stroke model
Six- to Eight-week-old of C57BL/6 J female mice were used for ischemic stroke model. Mice were deeply anesthetized by spontaneous inhalation of isoflurane, and temporalis muscle was removed. dMCAO model was modified from the original method57 and described previously56. Briefly, the right middle cerebral artery (MCA) was exposed by using an Ideal Micro-Drill (CellPoint Scientific; MD, U.S.A.) and the vessel was cauterized using a small vessel cauterizer (Gemini Cautery Kit, CellPoint Scientific). The hole was located at a position relative to bregma: 1.5 mm posterior and 6.5 mm lateral. The photothrombotic ischemia stroke mouse model was modified from the original method58 and prepared by the following methods. After the skin removal, the right side of the skull was covered with the polyvinyl chloride mask with a square whole. The square hole was 3 mm transverse (relative to bregma: 0.5 mm to 3.5 mm) and 5 mm longitudinal (relative to bregma: 3.5 mm to −1.5 mm). At 5 min after intraperitoneal injection of 10 mg/mL of Rose bengal, the exposed square area was illuminated for 10 min by a halogen lamp (model L-62; Hozan, Osaka, Japan).
JigSAP injection into the injured area
At 7 days after dMCAO or photothrombosis, the mice were deeply anesthetized by spontaneous inhalation of isoflurane. Glass capillaries were prepared using a puller (model GD-1; Narishige, Tokyo, Japan) to obtain around 100 µm-tip. The MCA for dMCAO model and the center of the square area for the photothrombic model was exposed again by tweezers and 2 µL of PBS, 1.0% JigSAP peptides, VEGF-JigSAP (1.6 ng), 1.0% JigSAP peptides mixed with VEGF (1.6 ng), and 1.0% JigSAP peptides mixed with VEGF-JigSAP (1.6 ng) were injected into the ischemic core (1 mm deeper from the surface of the brain) for 5 min using microinjector (MO-10; Narishige). For EdU-labeling, 50 µg/g body-weight of EdU was injected intraperitoneally 21 times every 8 h for 7 days.
Foot-fault test (FFT)
At 1 day before FFT, mice were placed on an elevated wire hexagonal grid with 60 mm wide openings, and allowed to roam freely for 10 min as a training. At the day of FFT test, we performed the same procedure. Mouse behavior was recorded during FFT and analyzed later. A misstep was counted as a foot fault when a limb fell down into an opening in the grid. The ratio of fault step number to total step number was calculated as a percentage. The data generated in this study are provided in the Source Data.
Immunohistostaining (IHC)
The mouse brains were fixed by transcardiac perfusion with 4% PFA in 0.1 M phosphate buffer, and post-fixed in the same fixative overnight at 4 °C. Floating coronal sections (100-µm thick) were prepared using a vibratome sectioning system (VT1000S; Leica, Heidelberg, Germany). The resulting sections were incubated for 60 min at room temperature in blocking solution (10% normal goat serum in PBS-Tx), overnight at 4 °C with primary antibodies, and then for 2 h at room temperature with Alexa Fluor-conjugated secondary antibodies (1:500). The primary antibodies used for IHC were rabbit anti-Iba1 (1:2000), mouse anti-NeuN (1:900), and rabbit anti-laminin (1:200) antibodies. For nuclear staining, 2 µg/mL DAPI was used. EdU-incorporated cells were visualized by click reaction using Alexa Fluor 647 Azide Triethylammonium Salt after the primary antibody reaction. FJC staining was performed after secondary antibody reaction using Fluoro-Jada C Ready-to-Dilute Staining Kit.
Cell counting using 2D and 3D stereology
The immunopositive cells and DAPI-stained cells were counted by unbiased 2D and 3D stereology (Stereo Investigator; MBF Bioscience VT, USA) for dissociated cells and sectioned tissues, respectively. For 2D stereology, a counting frame of 100×100-µm was used in 300×300-µm matrices. For 3D stereology, a counting frame of 100×100×10-µm was used in 300×300-µm matrices in each 400-µm section. Volume measurement was performed using the program of Stereo Investigator. Fluorescence images were captured using a fluorescence microscope (IX73; Olympus) and a CCD camera (C10600-10B; Hamamatsu Photonics) and a confocal microscope (LSM900 with Airyscan 2; Carl Zeiss, Germany). Box-plot elements show: center line, median; box limits, 25 and 75 percentiles; whiskers, (Q1/4–1.5IQR) and (Q3/4–1.5IQR). The data generated in this study are provided in the Source Data.
Statistics and reproducibility
Rheology measurements, CD spectrometric measurements, IR spectroscopic measurements, Fluorescence spectroscopic measurements, TEM observations, SAXS measurements were performed two times independently. Cell adhesion assay and HUVEC assays were performed two times independently. Incorporation assay and sustained-release assay were performed three times independently. For animal experiments, we used 7 mice for one group. We removed the data when the injured area was not detected after dMCAO. All of the data were included for analysis and put into one graph.
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this article.
