Animals and diets
All animal work was approved by the University of Massachusetts Medical School Institutional Animal Care Use Committee (IACUC protocol no.1600 to Michael P. Czech and no. 2007 to Silvia Corvera) with adherence to the laws of the United States and regulations of the Department of Agriculture. Mice were housed at 20–22 °C on a 12-hour light/12-hour dark cycle with ad libitum access to food and water. C57BL/6 J male mice were purchased from Jackson Laboratory for implant studies. C57BL/6 J (Jackson Laboratory) male mice were bred for primary preadipocyte cultures. Briefly, 10-week old male mice arrived and were allowed to acclimate for a week prior to any procedures. Baseline glucose tolerance tests were performed three days before implanting edited cells. Mice were implanted with edited primary mouse adipocytes at 11 weeks of age by anesthetizing prior to the implantation procedure using an anesthesia vaporizer chamber with a continuous flow 500 cc/minute of 02 with 3% (v/v) isoflurane for induction and 1.5% (v/v) for maintenance. After the cell injections, animals were allowed to wake up and were placed back in clean cages. Mice were maintained on a chow diet for the first 6 weeks, followed by a 60 kcal% fat diet (Research Diets, D12492i) for the remainder of the experiment from 6 to 16 weeks post implant. Glucose tolerance tests were performed after 16-hour overnight fasting with intraperitoneal injection of 1 g/kg D(+) glucose. Insulin tolerance tests were performed with 0.75 IU/kg after 6-hour daytime fasting. Male NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (denoted as NSG) mice were kindly donated by Taconic Biosciences, Inc. At 11 weeks of age NSG mice received implants with edited primary human adipocytes. Mice were maintained on a chow diet for the first 10 weeks, followed by placing them at thermoneutral environment with a 60 kcal% high fat diet (Research Diets, D12492i) for the remainder of the experiment from 10 to 15 weeks post implant. Housing under thermoneutrality was achieved by placing the NSG mice at 30 °C on a 12-hour light/12-hour dark cycle. Glucose tolerance tests with NSG mice were performed after a 16-hour fast with intraperitoneal injection 2 g/kg D(+) glucose. Whole blood was drawn and placed in EDTA-containing tubes from living mice with submandibular vein punctures under anesthesia as described above and in the end of the study with cardiac puncture. Plasma was extracted with centrifugation of whole blood for 15 min at 300 rcf at 4 °C.
Primary mouse preadipocyte isolation, culture and differentiation to primary adipocytes
2 to 3 week old C57BL/6 J male or female mice were euthanized and inguinal fat tissue was harvested (including lymph node) and placed in HBSS buffer (Gibco #14025) plus 3% (w/v) bovine serum albumin (BSA) (American Bioanalytical). The protocol was carried out as described previously34 with the following modifications: cells were incubated in 2 mg/mL collagenase (Sigma #C6885) in HBSS BSA 3% (w/v) for 20 min to digest the tissue. Cells were cultured to sub-confluence in complete media containing DMEM/F12 media (Gibco #11330), 1% (v/v) Penicillin/streptomycin, 10% (v/v) Fetal bovine serum (FBS) (Atlanta Biologicals #S11550), 100 μg/mL Normocin (Invivogen #Ant-nr-1) at which time they were transfected with RNPs by electroporation and re-plated. Αdipocyte differentiation was induced in the edited cells 24 h post confluence28. Briefly, adipogenic differentiation was initiated on day 0 with the addition of 5 μg/mL insulin, 1 μM dexamethasone, 0.5 mM 3-isobutyl-1-methylxanthine, 60 μM indomethacin and 1 μM rosiglitazone in the complete media. On day 2 (48 h later), the media was changed with complete media enriched with 5 μg/mL insulin and 1 μM rosiglitazone and on day 4 the media was changed with complete media enriched with 5 μg/mL insulin. By day 6 after differentiation the cells are considered fully differentiated and may continue to be cultured in complete media.
Human subjects
Abdominal subcutaneous adipose tissue was obtained from discarded tissue following panniculectomy. All subjects provided written consent to the use of tissue and all procedures were approved by the University of Massachusetts Institutional Review Board (IRB#14734_13). The research described here is not considered human subjects research according to the criteria of the DHHS and FDA, as the cells used were from previously obtained samples of adipose tissue from de-identified human subjects. The researchers in this study had no direct interactions with these human subjects or their identities.
Primary human preadipocyte isolation, culture and differentiation to primary adipocytes
Human preadipocytes were from previously de-identified explants of human abdominal subcutaneous adipose tissue from panniculectomy samples. The explants had been embedded and cultured in Matrigel, and cell suspensions from capillary growth were obtained using dispase and plated on standard tissue culture plates. Growth and passaging of these cells was performed using EGM-2 MV. This method was demonstrated to provide a large expansion of adipocyte progenitors from the vascular-like projections growing out of small pieces of human adipose tissue23. Human adipocyte progenitors were transfected with RNPs by electroporation and plated at a density greater than 70% confluence to allow for further expansion. Cells were grown to confluence, then adipogenic differentiation media was added to induce adipogenesis23,46. To induce adipogenesis, we used a minimal adipogenic cocktail of DMEM enriched with 10% (v/v) FBS and penicillin/streptomycin, 0.5 mM 3-isobutyl-1-methylxanthine, 1 μM dexamethasone and 1 μg/mL insulin (MDI) for 72 h. The medium was then replaced with DMEM plus 10% FBS. Subsequently, 50% of the medium was replaced with fresh medium every other day23,46. On day 10 post differentiation, cells were harvested for implantation in NSG mice by treating with 0.5 mg/mL collagenase in 1x Trypsin to detach from culture plates.
Transfection of primary preadipocytes (mouse and human) with RNPs
For ribonucleoprotein (RNP) transfection, we used the Neon Transfection System 100 μL Kit (ThermoFisher, #MPK10096) and we prepared a mix consisting unless otherwise specified of sgRNA 4 μM (Synthego or IDT DNA) purified SpyCas9 protein 3 μM PNA Bio, #CP02 or 3xNLS-SpCas947 (prepared by the Scot Wolfe laboratory) in Buffer R provided in the Neon Transfection System Kit. The cells were resuspended in Resuspension Buffer R for a final number of 0.5–6 × 106 cells per electroporation. For delivering the RNP complex into primary pre-adipocytes the electroporation parameters used were voltage 1350 V, width of pulse 30 ms; number of pulses 1 unless otherwise specified. The electroporated cells were placed in complete media immediately following transfection, expanded, grown to confluence and differentiated into mature adipocytes for downstream applications. We found these methods improved the viability of preadipocytes and adipocytes and their ability to differentiate over methods reported while our manuscript was in preparation48. The sequences for the sgRNAs used are reported in Table 1.
Implantation of primary mouse and human adipocytes
Primary mouse and human mature adipocytes on day 6 and 10 post differentiation, respectively, were washed twice with 1 x PBS. 0.5 mg/mL collagenase in 1 x trypsin was used to dissociate the cells from the plate. The detached cells are pelleted at 300 rcf for 10 min at room temperature. The cells were washed with 1 x PBS, pelleted, and the PBS was removed. Cell pellets were kept on ice for a brief time until implantation. Each mouse adipocyte pellet deriving from 1 × 150 mm fully confluent plate was mixed with matrigel (Corning® Matrigel® Growth Factor Reduced Basement Membrane Matrix, Phenol Red-free, LDEV-free # 356231) up to a total volume of 500 μL on ice and the cell and matrigel suspension (500 ± 20 μL) was drawn into a 1 mL syringe without the needle. The cell and Matrigel mixture was injected into the anesthetized mouse recipient with a 20 G needle by tenting the subcutaneous subscapular area, inserting the needle into the tented space and injecting at a slow but continuous rate to avoid cell rupture and solidification of the matrigel. The injection site was pinched gently for 1 min to allow the implant to solidify, followed by withdrawing the needle with a twisting motion. Each C57BL/6 J mouse recipient was injected with 2 × 150 mm plates of fully confluent murine adipocytes split into two bilateral injections in the subscapular area. Each NSG mouse recipient received 1 × 150 mm plate split into two 500 μL bilateral subcutaneous injections in the dorsal area as described above.
DNA harvest from cells and tissue
At two distinct time-points, 72 h following transfection and after primary adipocyte differentiation between day 6–10 post differentiation, genomic DNA was isolated from the transfected cells using DNA QuickExtract™ Buffer (Lucigen) in adherence to the manufacturer’s instructions.
Indel analysis by TIDE and ICE
Genomic DNA was PCR amplified for downstream analysis using locus specific primers designed with MacVector 17.0 and purchased from IDT DNA and Genewiz, spanning the region 800 bp around the expected DSB. For the PCR, Kappa 2x Hot start HiFi mix was used and PCR products were purified using the QIAgen DNA purification kit following the manufacturer’s instructions and submitted to Genewiz for Sanger Sequencing. Sanger sequencing trace data were analyzed with TIDE and ICE webtools (http://shinyapps.datacurators.nl/tide/, https://ice.synthego.com/#/) that decipher the composition of indels created at the sites of DSBs49,50. All primers used for the assessment of on-target and off-target editing are listed in Supplementary Table 1 in Supplementary Information file.
RNA isolation
Transfected cells were harvested for RNA between day 6–10, post-differentiation depending on the experiment by removing media and washing once with 1 x PBS, and adding Trizol reagent to lyse the cells. The protocol for RNA isolation was performed according to manufacturer’s instruction with the following modifications: 1 μL of Glycol blue (Invitrogen #AM9516) was added to the isopropanol to precipitate the RNA and was either stored overnight at −20 °C or placed on dry ice for 2 h. The isolated RNA was resuspended in RNase free water, then treated with recombinant DNase I (DNA-free DNA removal kit, Ambion) according to the manufacturer’s instructions. RNA concentrations were determined by Nanodrop 2000.
RNA isolation of pulverized tissue/tissue piece
Tissue was isolated from the mice and frozen in liquid N2. For RNA isolation, tissue was pulverized in liquid N2, or a piece approx. 100 mg in size was put in a 2 mL tube with screw cap and 1 mL of Trizol. Tissue was placed in the Qiagen TissueLyser and homogenized for 3 cycles of 3 min at 30 Hz. The Trizol and tissue lysate were placed in a new tube, and centrifuged for 10 min at 4 °C to separate any lipid from the homogenate. Once the homogenate is separated from the lipid, the remaining isolation is carried out according to manufacturer’s instructions.
RT-PCR
0.5−1 μg of RNA was used in 20 μL reaction with Bio-Rad iScript cDNA kit according to manufacturer’s protocol to synthesize cDNA. cDNA was diluted by adding 80 μL of water to the reaction and 5 μL of cDNA template was used for RT-PCR with Bio-Rad Sybr Green Mix and gene specific primers for a final concentration of 0.3 μM primers. Expression of genes was determined by comparing gene expression levels of target gene compared to housekeeping gene 36B4 and RPL4 for murine and human samples, respectively. mRNA expression was analyzed with the ΔΔCT method. All primers used for RT-PCR are listed in Supplementary Table 2 in Supplementary Information file.
Protein isolation
Cells grown in culture dishes were washed once with 1 x PBS at room temperature, followed by adding boiling 2% SDS (w/v) with 1 x HALT protease inhibitors and scraping to lyse the cells. Tissue pieces were prepared for western blots by homogenizing a piece ~100 mg in Radioimmunoprecipitation Assay (RIPA) buffer with 1 x HALT protease inhibitors in the Qiagen TissueLyser and homogenized for 3 cycles of 3 min at 30 Hz. Tissue and cell lysates prepared with 2% SDS (w/v) buffer or RIPA buffer were sonicated at 60% amplitude with a probe sonicator tip for 30 s at room temperature. In Fig. 1b, mouse cells were lysed as described above at different time-points after transfection and for timepoint 0 h, after the electroporation the transfection mix consisting of cells and RNPs in Buffer R was centrifugated at 300 rcf. The cell pellet was lysed as described above while the supernatant (sup) was also collected for use as positive control (SpyCas9 3 μM) in the western blot. Protein concentration determination of the tissue and cell lysates was performed using a bicinchoninic acid kit (BCA Protein Assay Kit, Pierce). Cell lysates used in immunoprecipitation reaction were prepared in non-denaturing NP-40 buffer (20 mM Tris HCl pH 8.0, 137 mM NaCl, 1% (v/v) Nonident P-40 (NP-40), 2 mM EDTA) containing 1X HALT protease inhibitors by washing once with 1 x PBS, adding NP-40 buffer and scraping, followed by a 4 °C incubation for 30 min to 1 h with gentle agitation. Cell lysates were centrifuged at 4 °C for 10 min at 16,100 rcf and the infranatant was collected and used. Protein concentrations were determined on the lysates using Pierce BCA Kit. Protein samples were prepared for running on 7.5–12% SDS-PAGE mini gels at a final concentration of 1 mg/mL protein, 1 x Laemmli loading buffer (BioRad) with 2.5% (v/v) β-Mercaptoethanol, followed by placing in a heat block at 95 °C for 10 min.
Oxygen consumption rate assay
Oxygen consumption assay was performed using the Cayman Oxygen Consumption Rate Assay Kit (Cayman Chemical #600800) and measured using a Tecan Saffire II. Briefly, primary pre-adipocytes (male or female) were plated in 96-well flat bottom plates after transfection with NTC- or NRIP1 sgRNA-M6-RNPs. Cells were grown to confluence, followed by differentiation. On day 7 post differentiation, oxygen consumption assays were performed. All chemicals used in the assay were diluted in OCR media consisting of DMEM/F12 media (Gibco #11330), 10% (v/v) Fetal bovine serum (FBS) (Atlanta Biologicals #S11550), 2% (w/v) Fatty Acid Free BSA (Sigma #8806) and prepared as batch-working solutions to reduce pipetting error. The contribution of mitochondrial oxygen consumption was determined by subtracting values obtained in the presence of antimycin A (1:29 final dilution, Cayman Chemical kit). Oligomycin was used at 2.5 μM final concentration, FCCP at 5 μM and 10 μM L-(−)-Norepinephrine (+)-bitartrate salt (Sigma #N5785) was added where indicated. Each well was covered with 100 μL of mineral oil to seal the wells from ambient oxygen. Kinetic measurements were carried out with the fluorescent excitation/emission wavelengths of 380/650 nm, and readings taken every 2 min for 120 min. This assay was performed in both male and female primary adipocytes multiple times and the data shown here is representative of the assays performed. The final data shown is the average of 3 technical replicates at each time point with the corresponding average 3 technical replicates of the antimycin A sample subtracted to reflect only mitochondrial respiration values.
Triglyceride assay
For the liver triglyceride assay, we used the Triglyceride Colorimetric assay kit (Cayman Chemical, #10010303). The lysate was prepared by mixing 50 mg of pulverized whole liver with 1.5 mL of the NP-40 lysis buffer and homogenized in the Qiagen TissueLyser with 3 cycles 3 min at 30 Hz. The assay ran according to manufacturer instructions with a sample dilution of 1:5.
Histology
Approximately 0.5 cm2 of the implant tissue and two 0.5 cm2 liver pieces from two different lobes per recipient were randomly selected and fixed, followed by processing at the UMass Medical School Morphology Core. Photos of the tissues were taken with an LEICA DM 2500 LED inverted microscope at indicated magnification. Fiji/ImageJ was used to quantify lipid content in H&E images. 4 images per section, 2 sections per liver, were projected into a single montage. The montage was converted from RGB to 8 bit, contrast enhanced, thresholded and binarized. The processed montage was reconverted into individual images and lipid droplets quantified for each image using the particle analysis function (number, size, % of area covered).
Western blotting and immunoprecipitation
Protein lysates were run on 7.5% and 12% SDS-PAGE or Mini-Protean TGX stain-free pre-cast protein gels, followed by transferring the proteins to Nitrocellulose. Unless otherwise stated, a total of 20 μg of protein lysate was loaded per well. Nitrocellulose membranes were blocked using 5% (w/v) Non-fat milk in Tris buffered saline with 0.1% (v/v) Tween-20 (TBST) for 1 h at room temperature. Primary antibody incubations were carried out in 5% (w/v) BSA in TBST at the following antibody concentrations: UCP1-Abcam#10983, 1:700; Rip140-Millipore #MABS1917, 1:1000, Tubulin-Sigma #T5168, 1:4000; GAPDH-Cell Signaling #21185, 1:1000; SpyCas9-Cell Signaling #19526 S 1:5000, OXPHOS Abcam #110413, 1:1000. Blots and primary antibodies were incubated overnight with a roller mixer at 4 °C. Membranes were washed with TBST prior to secondary antibody incubations. HRP-conjugated secondary antibodies were diluted with 5% BSA (w/v) in TBST at 1:5,000–10,000 for 45 min at room temperature with constant shaking. Membranes were washed in TBST, followed by incubating with Perkin Elmer Western Lightning Enhance ECL. The Bio-Rad Chemi-Doc XRS was used to image the chemiluminescence and quantifications were performed using the system software, or Image J v.1.51. Immunoprecipitation was performed with NP-40/Halt protein lysates. Briefly, 250 μg of protein lysates were pre-cleared using 50:50 Protein-A Sepharose/NP-40 buffer/1 x HALT protease inhibitors for 2 h at 4 °C with end over end mixing. After 2 h, the lysate/Protein A Sepharose was centrifuged for 5 s to pellet the Sepharose, and the lysate was transferred to a new tube. 5 μg of Antibody (Rabbit Non-Immune IgG, Millipore #12-370, or Rabbit anti-Nrip1, Abcam #Ab42126) was added to the lysates and they were incubated overnight at 4 °C with end over end mixing. Antibody/antigen was pulled down by adding 50:50 Protein A Sepharose/NP-40 buffer/1 x HALT protease inhibitors for an additional 2 h at 4 °C with end over end mixing. Protein/Antibody/Protein A Sepharose complexes were washed by centrifuging briefly, removing the supernatant and washing the pellet with NP-40 buffer containing protease inhibitors. The captured proteins were eluted from the Sepharose by adding 40 μL of 1 x Laemmli buffer containing 2.5% (v/v) β-Mercaptoethanol, vortexing the Sepharose mixture, followed by boiling at 95 °C for 10 min. All eluted proteins were run on the gel, transferred to nitrocellulose, and immunoblotted as described above.
RNA-sequencing
RNA was isolated on day 6 post differentiation and treated with DNase treatment as described, and 2 μg of total RNA was submitted to GENEWIZ for standard RNA sequencing (Illumina HiSeq). The data were acquired demultiplexed in the form of FASTQ files. Alignment and quantification of gene expression levels were performed using the DolphinNext RNA-seq pipeline (revision 3)51. Parameters for the pipeline were set to remove Illumina 3′ adapter sequences using trimmomatic software (v 0.39) with seed mismatches set to 2, a palindrome clip threshold of 30 and a simple clip threshold of 552. The DolphinNext pipeline used RSEM (v1.3.1) to align RNA-Seq reads to a mouse reference transcript (using the RSEM reference STAR and and Bowtie genomes) to estimate gene expression levels53. DESeq2 software (v 1.28.1) was then used on these expression levels to find differentially expressed (DE) genes between two groups of samples. We set the parameters test = “LRT” (Likelihood Ratio Test), fitType = “parametric”, betaPrior = FALSE, and reduced = ~1 (to compare to the control group). Alpha (padj) was set to 0.1 and a minFC = 1.3 was specified54. Once DE genes were found, enriched pathways were identified using the biomaRt (v 2.44.2) enrichGO routine. Parameters for this routine were set to orgDb = “org.Mm.eg.db”, pAdjustMethod = “fdr”, p valueCutoff = 0.05, ont = “BP”, and minGSSize = 1055. The “universe” was set to all the genes found by RSEM. Similar pathways were combined using clusterProfiler’s (v 3.16.1) simplify() function. The top 10 pathways were then displayed using the dotplot routine from the enrichplot package (version 1.8.1, loaded by clusterProfiler)56. Pathways where further culled or merged based on pathway names specified manually. Heatmaps of selected genes were generated using the normalized (for sample depth) values returned by the DESeq2 counts (ddsRES, normalized = TRUE) function. Prior to display values were standardized (each gene had its mean expression level subtracted and was then divided by the gene’s standard deviation). The gplots package (v 3.1.0) was then used, via the heatmap.2 function, to display the heatmap. Custom software was written to combine lists of genes from many pathways to create the gene list used in the “stacked pathway heatmap”, which was then displayed using heatmap.2. Principal component analysis was applied to the normalized data (DESeq2 getNormalizedMatrix() with method = “MRN”). The debrowser package’s (v 1.16.3) run_pca() routine was used to calculate the principal components; it centers and scales the data prior to calculating the principal components57,58,59.
Human adiponectin
Human adiponectin in the plasma of NSG mice was measured using a human-specific adiponectin ELISA from Invitrogen (KHP0041).
Plasmid construction
The pCS2-Dest plasmid with CMV promoter expressing SpyCas9 (Addgene # 69220), and sgRNA expressing plasmid (Addgene #52628) were a gift from Dr. Scot Wolfe lab. To clone NRIP1 targeting and non-targeting sgRNAs, oligo spacers with BfuAI overhangs (purchased from IDT) were annealed and cloned into the BfuAI-digested sgRNA plasmid. Lonza pmaxGFP LOT 2-00096 was used to test transfection of these plasmids in various concentrations to determine the efficient dosage range (0.5–1.5 μg) and the electroporation conditions (1350 V, 30 ms, 1 pulse) for the delivery and GFP expression was evaluated with EVOS FL fluorescent microscope (Thermo Fisher Scientific).
Plasma cytokine and chemokine analysis
Whole blood was collected from the mouse recipients with cardiac puncture at the end of the studies and placed in EDTA containing tubes. The plasma was collected after a 15 min centrifugation at 2000 rcf and 4 oC. Multiplex analysis of plasma cytokines and chemokines was performed by the Luminex system. For positive controls, 4 C57BL6/J mice age and gender-matched to the recipients with body weights ranging from 34 to 40 g were injected with 1 μg LPS diluted in PBS and their plasma was collected as described above 2 h after injections. For the data analysis, the measurements found to be below the detectable cut-off were considered as 0 as a lowest value of 0.4 pg/mL was measured.
GUIDE-seq
In order to obtain results that correspond to our CRISPR delivery method and cell-type, we modified the GUIDE-seq transfection protocol38 using our standard RNP concentration and electroporation method combined with the dsODN in various amounts (7.5, 10, 20, 30, 50, 80, 100 pmols) to achieve optimal on-target editing and dsODN integration. Three days after transfection, genomic DNA was isolated using the DNeasy Blood and Tissue kit (Qiagen) according to manufacturer’s instructions. GUIDE-seq libraries were prepared using the custom oligos and adapters according to Table 2 with the sequences provided below. The barcoded libraries were sequenced on a MiniSeq platform in a paired end “147 | 8 | 16 | 147” run. Sequencer output was demultiplexed, trimmed and aligned according to a published workflow60. Positive- and negative-strand BAM files, along with a UMI reference, were processed as GUIDEseq61 inputs with parameters allowing for an NGG PAM and 10 or fewer mismatches.
Index1: ATCACCGACTGCCCATAGAGAGGACTCCAGTCAC
Read2: GTGACTGGAGTCCTCTCTATGGGCAGTCGGTGAT
P7 Adapters Sequence (5′ → 3′) (Index 2):
P701: CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTGACTGGAGTCCTCTCTATGGGCAGTCGGTGA
P702:
CAAGCAGAAGACGGCATACGAGATCTAGTACGGTGACTGGAGTCCTCTCTATGGGCAGTCGGTGA
P703: CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTGACTGGAGTCCTCTCTATGGGCAGTCGGTGA
P704: CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTGACTGGAGTCCTCTCTATGGGCAGTCGGTGA
P705:
CAAGCAGAAGACGGCATACGAGATAGGAGTCCGTGACTGGAGTCCTCTCTATGGGCAGTCGGTGA
P706: CAAGCAGAAGACGGCATACGAGATCATGCCTAGTGACTGGAGTCCTCTCTATGGGCAGTCGGTGA
P707: CAAGCAGAAGACGGCATACGAGATGTAGAGAGGTGACTGGAGTCCTCTCTATGGGCAGTCGGTGA
P708: CAAGCAGAAGACGGCATACGAGATCCTCTCTGGTGACTGGAGTCCTCTCTATGGGCAGTCGGTGA
Adapter Sequences (Index 1):
A01: AATGATACGGCGACCACCGAGATCTACACTAGATCGCNNWNNWNNACACTCTTTCCCTACACGACGCTCTTCCGATC*T
A02: AATGATACGGCGACCACCGAGATCTACACCTCTCTATNNWNNWNNACACTCTTTCCCTACACGACGCTCTTCCGATC*T
A03: AATGATACGGCGACCACCGAGATCTACACTATCCTCTNNWNNWNNACACTCTTTCCCTACACGACGCTCTTCCGATC*T
A04: AATGATACGGCGACCACCGAGATCTACACAGAGTAGANNWNNWNNACACTCTTTCCCTACACGACGCTCTTCCGATC*T
Amplicon sequencing analysis of on- and off-target editing
Genomic DNA was isolated from both human and mouse NTC or NRIP1KO adipocytes after day 6 post differentiation n [NTC] = 3; n [NRIP1KO] = 3 per amplicon. Illumina amplicon sequencing library was prepared using a two-step PCR protocol. During PCR1, regions of interest (around 290 bp) were amplified as follows: 98 °C for 2 min, 24 cycles of 98 °C for 15 sec −64 °C for 20 sec −72 °C for 15 sec, and 72 °C for 5 min, in a reaction mix of 50 ng genomic DNA, 10 μM forward and reverse primers that contain Illumina adapter sequences 1 μL each, 12.5 μL NEBNext UltraII Q5 Master Mix, and water to bring the total volume to 25 μL. PCR1 primer sequences are in Supplementary Table 1 in the Supplementary information file. Then, PCR2 was performed as follows: 98 °C for 2 min, 10 cycles of 98 °C for 15 sec −64 °C for 20 sec −72 °C for 15 sec, and 72 °C for 5 min, in a reaction mix of 5 μL of total PCR1 product, 10 μM forward and reverse primers that contain unique barcode sequences 2 μL each, 25 μL NEBNext UltraII Q5 Master Mix, and water to bring the total volume to 50 μL. Index sequences used in PCR2 are in Table 3. PCR2 products were first purified (Zymo PCR purification kit), visualized using 1.5% agarose gel electrophoresis, and pooled together for similar amounts based on the band intensities. Pooled PCR2 products ran on 2% agarose gel electrophoresis and cut for desired bands (around 400 bp) for gel extraction (Zymoclean DNA Gel recovery kit). Concentration of the final purified library was determined using Qubit (High Sensitivity DNA assay). The integrity of the library was confirmed by Agilent Tapestation using Agilent High Sensitivity D1000 ScreenTape kit. The library was sequenced on an Illumina Miniseq platform according to the manufacturer’s instructions using Miniseq Mid Output Kit (300-cycles) in a paired end “151 | 6 | 8 | 151” run. CRISPResso2 was used to align the reads and quantify the editing62.
Statistics and reproducibility
Experiments with primary mouse adipocytes in vitro were performed multiple times with sgRNA-M6 by independent investigators. For the experiments in Figure panels 1c, d, e, h, i we performed biologically independent replicates between 2 and 8 times. In Fig. 1g and 1i, we performed biological replicates between 2 and 4 times depending on the guide used. In Fig. 2c we performed the titration of cas9 and sgRNA one time. In Fig. 2d the oxidative phosphorylation western blot was performed one time with all guides represented in a single experiment and 4 times with guide NTC and sgRNA-M6. Figure panels 2e–j oxygen consumption analysis was performed in male primary adipocytes 4 times and 2 times in female primary adipocytes. Regarding Fig. 3 and Supplementary Fig. 4, four independent cohorts were studied sequentially in time following the same protocol as described above. Each of these cohorts included both conditions (NTC, NRIP1KO murine implants) with the following number of mice: in cohort 1 included n (NTC) = 2 and n (NRIP1KO) = 2, in cohort 2 n (NTC) = 2 and n (NRIP1KO) = 1, in cohort 3 n (NTC) = 3 and n (NRIP1KO) = 5, in cohort 4 n (NTC) = 6 and n (NRIP1KO) = 6 where n represents a population consisting of separate mice. The phenotype described in this study was consistent among all cohorts. All mice were followed up with the same protocol during the study including body weight measurements, glucose tolerance tests, while in post mortem the animals were split into different analysis. Macroscopic and histology images are representative. For steatosis quantification in H&E sections, multiple images of randomly selected sections were used at three different levels of the liver preparations. In Figs. 4 and 6, RNA samples for RNA sequencing were submitted from biologically independent experiments. Sample images shown in Fig. 5d of NRIP1KO in human primary adipocytes has been performed up to 4 times. For the experiments in Figure panels 5b, c, d, e, g we performed biologically independent replicates between 2 and 8 times. In vitro experiment Fig. 5f was performed two times. Figure 5h experiment was performed with 2 biological replicates and one of the sets of biological replicates was run in the western blot one time. In vivo data presented in Fig. 7 derive from one cohort of NGS mice which included both conditions with sample size (NTC) = 4 and n (NRIP1KO) = 6 where n represents a population consisting of separate mice. All comparisons between two groups were performed with student unpaired two-tailed T Test with the following demonstration of p values in the panels: *p < 0.05, **p < 0.01, ***p < 0.001. In data that normal distribution cannot be assumed or proven, normalization to equal standard distributions preceded the statistical analysis. All p values, t values and degrees of freedom are reported in the raw data file. All comparisons between more than two groups (Fig. 4, Supplementary Fig. 4k) were performed with one-way ANOVA and multiple comparison’s in those were performed with Dunnett’s multiple comparisons test. P value, F value are provided in the raw data file. Statistics used in the oxygen consumption analysis (Fig. 2e, f, h, i) were One-way ANOVA with Sidak’s multiple comparison test and two—way ANOVA for the 40 min timepoint summary (Fig. 2g, h) with Sidak’s multiple comparison test.
Databases, software and online tools
For the mapping of exons on the Nrip1 gene we used IGV_2.5.3. For the Design of sgRNAs we used a combination of the Broad Institute sgRNA designer, CHOPCHOP and the online sgRNA checkers by Synthego and IDT. For the design of genomic DNA primers we used MacVector 17.0. For the alignment of the Sanger Sequencing traces and the human and mouse coding region we used SnapGene Viewer 5.1.6 and NCBI nucleotide blast. For the design of RT-PCR primers we used Primer Bank (https://pga.mgh.harvard.edu/primerbank/). For the browning probability potential, the unnormalized mapped read counts were applied in the ProFAT online tool37. Off-target diagrams were generated from GUIDEseq output using a freely available visualization tool (https://mismatch.netlify.app). For the data graphing, we used Prism GraphPad 9 unless otherwise specified.
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this article.
