Cell culture
HEK293 (ATCC® CRL-1573™), A549 (ATCC® CCL-185™), HeLa (ATCC® CCL-2™), U2OS (ATCC® HTB-96), HepG2 (ATCC® HB-8065) and HepG2-NTCP-K7 [10] cell lines were maintained in Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F-12, Gibco, Carlsbad, USA) supplemented with 10% heat-inactivated fetal calf serum (FCS; Gibco) and 1% penicillin/streptomycin (10.000 U/mL, Gibco) in a humidified 37 °C, 5% CO2 incubator. HepaRG cell line (RRID:CVCL_9720) was cultivated in William’s E medium supplemented with 10% FBS Fetalclone II (Thermo Fisher Scientific, Waltham, MA, USA), 1% penicillin/streptomycin, 2 mM glutamine, 0.023 U/mL human insulin, 0.0047 mg/mL hydrocortisone and 0.08/mL gentamicin (Gibco). HepG2, HepG2-NTCP-K7 and HepaRG cells were cultivated on collagen-coated plates, HEK293 cell line on poly-l-lysine coated plates. To differentiate HepG2 and HepG2-NTCP-K7 cells, 2.5% DMSO was added to the cell culture medium for 3 days when cells were sub confluent. For differentiation of HepaRG, cells were first cultivated for 2 weeks in standard medium, followed by cultivation in medium supplemented with 1.8% DMSO for another 2 weeks. All experiments were performed in 24 well plates using 500 µL of standard cultivation medium per well.
Cloning and mRNA production
NTCP cDNA was synthesized by reverse transcription of mRNA isolated from differentiated HepaRG cells. The open reading frame of NTCP was amplified by PCR, supplied with a GSGS-linker, fused to tdTomato and inserted into pcDNA3.1 backbone under control of either CMV or T7 promotors. tdTomato-N1 was a gift from Michael Davidson & Nathan Shaner & Roger Tsien (Addgene plasmid # 54642). For mRNA production both plasmids (pDNA-NTCP, pDNA-NTCP-tdTomato) were linearized downstream of the coding sequence with EcoRI (Thermo Fisher Scientific) for 1 h at 37 °C and precipitated overnight at − 20 °C using 1:20 0.5 M EDTA, 1:10 5 M NHaO2 and 1:1 100% ethanol. After washing with 100% ethanol, 1 µg of linearized plasmid was used for mRNA synthesis using HiScribe ARCA T7 in vitro transcription kit (New England Biolabs, Ipswich, MA, USA) supplemented with 10 µM ψ-UTP and 10 µM m5CTP (Jena Bioscience, Jena, Germany) nucleotide analogs as indicated. Thereby, production of IVT mRNA was subdivided in 2 steps: (1) ARCA capping and synthesis of IVT mRNA and (2) a subsequent addition of a poly-A tail. Synthesized IVT mRNA was analyzed on 2% agarose gel to validate correct length and tailing efficiency.
Transfection and transduction
For mRNA and poly I:C transfection, Lipofectamine Messenger Max (Invitrogen, Carlsbad, CA, USA) was used in 1:3 ratio. pDNA transfection was performed with Lipofectamine 2000 (Invitrogen) in 1:2 ratio. mRNA and Lipofectamine incubated for 10 min, plasmid and Lipofectamine for 5 min at room temperature. DNA and mRNA lipoplexes were added to cells, cultivated in standard cultivation medium. To produce recombinant Ad-NTCP-tdTomato, the NTCP-tdTomato expression cassette was inserted into the pEntry plasmid, under control of a transthyretin receptor promoter, and recombined into an Ad5 genome, using the Gateway™ system (Thermo Fisher Scientific). The resulting pAd-NTCP-tdTomato plasmid was linearized with PacI and transfected in HEK293 cells. Four to 6 days post transfection, recombinant adenoviruses were harvested, using multiple freeze–thaw steps, and propagated by subsequent transduction into fresh 293 cells, before final harvest. Ad-NTCP-tdTomato was titrated on 293 cells by immunofluorescence to determine infectious units (IU) and added to cell culture medium to obtain a desired multiplicity of infection (MOI). One day post transfection or transduction medium was replaced with fresh cultivation medium. Cell viability was determined using the Cell Titer Blue assay (Promega, Madison, WI, USA) according to manufacturer’s instruction using 1:5 dilution of the reagent in standard cultivation medium. Fluorescence measurement (560(20)Ex/590(10)Em) was performed using M200 Infinite platereader (Tecan, Männedorf, Switzerland).
Western blot
Protein lysates were obtained as previously described5. To remove glycosyl residues, protein lysates were treated with peptide N-glycosidase (New England Biolabs). Proteins were separated by SDS-PAGE and NTCP expression was analyzed by Western blot using rabbit antiserum K9 (kindly provided by B. Stieger) and goat anti-rabbit-HRP (Sigma-Aldrich, St. Louis, MO, USA) for detection. β-Actin was detected using mouse anti-β-Actin and goat anti-mouse-HRP (both Sigma-Aldrich). Images were obtained using Chemostar software (Intas Science Imaging, Göttlingen, Germany) and were further processed using Image J (National Institutes of Health (NIH), Bethesda, MD, USA).
Radioactive bile acid uptake assay
Analysis of [3H] taurocholate uptake was performed as previously described49. Briefly, negative samples were incubated for 15 min at 37 °C with 200 nM MyrB diluted in 250 µL basal medium. Next, Hot Mix stock (1940 µL basal medium, 66 µL 15 mM cold TC (Sigma-Aldrich) and 1 µL hot TC (Hartmann Analytic, Braunschweig, Germany) was diluted 1:10 in basal medium, 25 µL were added to the preincubated samples and incubated for 15 min at 37 °C. After incubation, cells were placed on ice, Hot Mix was removed and cells were washed 3 times with ice-cold PBS. Next, 500 µL lysis buffer (0.05% SDS, 0.25 mM NaOH) were added and lysed cells were transferred to scintillation vials. Afterwards, 4 mL scintillation liquid was added, vials were closed and vortexed for 30 s. Measurement of [3H] taurocholate was performed with scintillation analyzer.
Flow cytometry and fluorescence microscopy
For analysis of NTCP expression, 200 nM Atto488 labeled Myrcludex B (MyrBAtto488) was added to culture medium and incubated for 30 min at 37 °C. Unbound MyrBAtto488 was removed by washing with PBS. For flow cytometry analysis, cells were detached with trypsin, resuspended in PBS supplemented with 1% FCS and 1 mM EDTA and washed 3 × times with PBS. For HBV core staining cells were treated using BD Cytofix/Cytoperm Fixation/Permeablization Kit (Becton Dickinson, Franklin Lakes, NJ, USA) according to manufacturer’s instructions using Hepatitis B Virus Core Antigen Rabbit Polyclonal Antibody (1:1000, Cell Marque, Rocklin, CA, USA) and PE F(ab’)2 Donkey anti-rabbit IgG (1:10, #558416, Becton Dickinson) Analysis of MyrBAtto488 staining, NTCP-tdTomato and HBV core expression was performed with fluorescence microscope Leica DM8i (Leica Biosystems, Wetzlar, Germany) or flow cytometry (Cytoflex, Beckman Coulter, Brea, CA, USA). Fluorescence images were obtained using Leica Application Suite X (LAS X, Leica, Wetzlar, Germany). Data analysis of flow cytometry data was performed using FlowJo, LLC (Becton Dickinson).
Quantification of various factors by qPCR
Nucleospin Tissue Kit was utilized for total cellular DNA extraction (Macherey&Nagel, Düren, Germany) according to manufacturer’s instructions. Total intracellular HBV DNA (primers: HBV1745 GTTGCCCGTTTGTCCTCTAATTC; HBV1844 GGAGGGATACATAGAGGTTCC-TTGA) and human prion protein PRNP (primers: PRNPfwd TGCTGGGAAGTGCCATGAG; PRNPrev CGGTGCATGTTTTCACGATAGTA) as a reference gene were amplified by qPCR on a LightCycler 480 system using SYBR Green I Master (Roche, Mannheim, Germany). For selective cccDNA detection (primers: ccc2251− AGCTGAGGCGGTATCTA; ccc92+ GCCTATTGATTGGAAAG-TATGT), samples were pretreated with T5 exonuclease (New England Biolabs) digestion. Cycling programs were used as described previously50. For total RNA isolation Nucleospin RNA extraction kit was used (Macherey&Nagel) and cDNA synthesis was performed using Superscript III First-Strand Synthesis SuperMix (Invitrogen) according to manufacturer’s instructions. Quantification of IFNβ (primers: IFNβfwd TTCAGTGTCAGAAGCTCCTGTGG; IFNβrev CTGCTTAATCTCCTCAGGGATGTCA) was performed relative to 18S ribosomal RNA (primers: 18Sfwd AAACGGCTACCACATCCAAG; 18Srev CCTCCAATGGATCCTCGTTA) using previously described protocol33.
HBV uptake and infection
HBV uptake assay and infection were performed as previously described10,32. HBV stocks were prepared by heparin column purification and subsequent sucrose gradient centrifugation as described51. DNA-containing, enveloped particles (virions) were determined for calculation of the MOI. Qualitative Hepatitis B e antigen (HBeAg) measurement was performed using a commercial immunoassay (BEP III, Siemens Molecular Diagnostics, Marburg, Germany). Sample/Cut-off was determined using internal Cut-off value where samples > 1 are considered as positive. Quantitative HBeAg analysis was obtained using the HBeAg Reagent Kit with HBeAg Quantitative Calibrators on the Architect™ platform (Abbott Laboratories, Chicago, IL, USA).
