Preloader

A LexAop > UAS > QUAS trimeric plasmid to generate inducible and interconvertible Drosophila overexpression transgenes

Molecular cloning

All PCRs were performed with Q5 High-Fidelity polymerase from New England Biolabs (NEB, M0492 L). Standard subcloning protocols were used to generate all the DNA plasmids (see details below). Genomic DNA was extracted via standard protocols21 and used as a template to amplify different DNA fragments. Transgenic flies harbouring the new transgenes were obtained by attP/attB PhiC31-mediated integration (see the specific details below). Some of the transgenes were generated by Bestgene Inc., while others were generated in house by Sangbin Park. The fly strains generated will be deposited at the Bloomington Stock Centre. While resources are transferred to Bloomington, reagents will be provided upon reasonable request.

Generation of the Module Vector (MV)

The different modules included in the vector were first designed in silico using SnapGene software. Each module contains 5 repeats of each upstream regulatory sequence type, followed by an hsp-70 minimal promoter. Each module was also flanked by specific recombination sites (see diagram Fig. 1). This fragment was synthesized as a large DNA fragment by GENEWIZZ and subcloned into the PUC57 vector. The modular construct was then extracted from PUC57 as a SpeI-KpnI fragment and subcloned into a UASt-attB-mini-white11 vector previously digested with NheI-KpnI. PmeI, XhoI, and KpnI are potential unique restriction sites available for conventional cloning downstream of the gene regulatory elements (see diagram Fig. 1). Sequence of the plasmid is provided as Supplementary Text information.

Generation of βTub85D-mFlp5 and βTub85D-CreV5 transgenic flies

We extracted genomic DNA and amplified a βTub85D promoter via PCR using the following primers:

Forward primer βTub85D-promoter:

5’ ttattatccctaggcagctgtggactcctcattgtagg 3’

Reverse primer βTub85D-promoter:

5’ aaatttaatctgcaggcggccgcgaattcaagcttcgcccctttttcacaccg 3’

Convenient restriction sites for cloning were placed at the 5’ (AvrII) and 3’ (NotI and EcoRI) ends of the PCR product. We then digested a UASt-attB-mini-white vector with NheI and EcoRI, thus replacing the UAS repeats with the βTub85D-promoter but keeping the rest of the plasmid backbone. PCR was digested with AvrII and EcoRI and ligated with the aforementioned backbone, creating an intermediate plasmid (βTub85D-attB-mini-white plasmid) suitable to subclone the cDNA of mFlp5 and CreV5. mFlp5 cDNA was amplified via PCR from a plasmid vector kindly provided by Iris Salecker using the following primers:

Forward primer mFlp5:

5’
attacagttGCGGCCGCatgccacaatttgatatattatgtaaaacacc 3’

Reverse primer mFlp5:

5’ AAtATAaaggcctTctagattatatgcgtctatttatgtagg 3’

The NotI and StuI restriction sites were conveniently placed in the PCR product of mFlp5 to facilitate cloning in the βTub85D-attB plasmid. Before ligation, the βTub85D-attB plasmid and the mFlp5 PCR product were digested with NotI and StuI. This construct was inserted in the attP site of the Bloomington Stock Number 9740.

To generate the βTub85DCreV5attB-mini-white vector, we replaced the UAS repeats included in UASt-Crev5-attB-mini-white plasmids previously generated in the laboratory with the Beta2-Tubulin minimal promoter. To that end and prior to ligation, we digested the UASt-CreV5-attB-mini-white plasmid and the βTub85D-promoter PCR product with NheI-EcoRI. Note that Cre was tagged with the V5 epitope. This construct was inserted in the attP site of the Bloomington Stock Number 9738 to generate the corresponding transgenic line.

MV-HA-VC

The VC fragment corresponding to the split Venus GFP12 was amplified by PCR with the primers indicated below using as template the Addgene plasmid number 22011. The HA epitope was incorporated in the N-terminus within the forward primer. Primers also contained suitable restriction sites to facilitate subcloning. The PCR product was first subcloned as a PmeI-XhoI fragment in a customised Actin5C-SV40-polyA-attB-mini-white plasmid22. Finally, the HA-VC fragment with the SV40 polyA was subcloned in the MV vector using the PmeI-SpeI restriction sites. Sequence of the plasmid will be provided upon request until the vector is deposited in a public repository. This construct was inserted in the attP site of the Bloomington Stock Number 9752 to generate the corresponding transgenic line.

Forward primer HA-VC:

5’ttaggcggtttaaacgcggccgcgccaccgacgtcatgtacccatacgatgttccagattacgctggggccgcgg

ccggggacaagcagaagaacg 3’

Reverse primer VC:

5’attatagagctcgaggtaccctactattacttgtacagctcgtccatgccgagagtgatccc 3’

MV-Dronc-V5-VC

The Dronc-V5-VC fragment was synthesized by Twist Bioscience. Wild-type cDNA of Dronc was fused to the V5 and VC peptides at the C-terminus. The constructs were subcloned in the MV vector using PmeI-KpnI restriction sites. Sequence of the plasmid will be provided upon request until the vector is deposited in a public repository. This construct was inserted in the attP site of the Bloomington Stock Number 9752 to generate the corresponding transgenic line.

MV-wg-RNAi

The construct was built using the primers indicated below. The primers incorporate the inverted repeats for targeting the gene wingless previously described in the Drosophila TRiP collection (HMS00844) (https://fgr.hms.harvard.edu/fly in vivo-rnai). The primers were synthesized and subsequently annealed as follows. We prepare 50 µl of a solution containing both oligos (final concertation 20 µM) in buffer 2.1 10X (New England Biolabs) and the corresponding water volume. This mix was heated for 5 min in a thermoblock and left at room temperature during 2 h prior ligation in the MV vector opened with PmeI-KpnI restriction sites. This construct was inserted in the attP site of the Bloomington Stock Number 9753 to generate the corresponding transgenic line.

Forward primer:

5’ aaaccagttagctcgatatgaatataatatagttatattcaagcatatattatattcatatcgagctagcggtac 3’

Reverse primer:

5’ cgctagctcgatatgaatataatatatgcttgaatataactatattatattcatatcgagctaactggttt 3’

Fly Husbandry and full description of genotypes

All fly strains used are described at www.flybase.bio.indiana.edu unless otherwise indicated. Primary Drosophila strains and experiments were routinely maintained on Oxford fly food at 25 °C.

Full genotype description

Figure 1

1b: salm-Gal4/MVHA-VC.

1c: MVHA-VC/ + ; dpp-LexA/ + 

1d: MVHA-VC/ + ; hh-QF/ + 

1e: salm-Gal4/MVHA-VC; hh-QF/ + 

1f.: salm-Gal4/MVHA-VC; dpp-LexA/ + 

1 g: MVDronc-V5-VC/Cyo; hh-Gal4/ + 

MV-Dronc-V5-VC/Cyo; hh-LexA/ + 

MV-Dronc-V5-VC/Cyo; hh-QF/ + 

CTRL: + /Cyo; hh-LexA/ + 

Figure 2

2a: hsFlp1.22; salm-Gal4/MVDronc-V5-VC

2b: MVDronc-V5-VC/ + ; dpp-LexA/hs-mFlp5

2c: MVDronc-V5-VC/hs-Cre; hh-QF/ + 

Figure 3

3b-c: The genotypes are indicated in the figure

3d and 3e:

MV-Dronc-V5-VC/Cyo; hh-Gal4/+ using a MV-Dronc-V5-VC transgene with (+ QUAS) or without (- QUAS) repeats. The QUAS repeats were permanently removed in the germline following the protocol described in Figure 3.

Supplementary Fig. 1

1b: salm-Gal4/MVHA-VC; hh-QF/ + 

1d: salm-Gal4/MVDronc-V5-VC; dpp-LexA/ + 

1e: salm-Gal4/MVDronc-V5-VC; hh-QF/ + 

Supplementary Fig. 2

2a: Genotypes are the same than in the Fig. 1g.

2b and 2e:

MV-Dronc-V5-VC/Cyo; hh-Gal4/ + 

MV-Dronc-V5-VC/Cyo; hh-LexA/ + 

MV-Dronc-V5-VC/Cyo; hh-QF/ + 

Supplementary Fig. 3

3a: hs-Flp1.22; salm-Gal4/MVDronc-V5-VC.

3b: MVDronc-V5-VC/hs-Cre; hh-QF/ + 

3c: MVDronc-V5-VC/ + ; dpp-LexA/hs-mFlp5.

Immunohistochemistry

Third instar larvae were dissected on ice-cold PBS. The larvae were then fixed and immunostained following standard protocols (fixing solution 4% paraformaldehyde diluted in PBS 1X; washing solution 0.3% Triton X-100 diluted in PBS 1X). The primary antibodies used in our experiments were anti-GFP (goat, 1:400; Abcam, ab6673), anti-Ptc (1:200, Hybridoma Bank, Apa1), anti-V5 (mouse 1:200, Thermofisher R960-25) and anti-HA (rabbit 1:500, Cell Signaling 3724). We diluted the secondary antibodies in a solution 0.3% Triton X-100 diluted in PBS 1X to detect the primary antibodies: anti-goat Alexa 488 (A1105), anti-mouse Alexa 555 (A31570), and anti-rabbit Alexa 647 (A31573). All of the secondary antibodies were from Life Technologies and were used at a standard concentration of 1:200. DAPI was added to the solution with secondary antibodies to label the DNA (1:1000; Thermo Scientific 62248). After incubation for 2 h with the secondary antibodies, samples were washed 3 times in a solution 0.3% Triton X-100 diluted in PBS 1X for 5 min and mounted in Vectashield.

Western Blot

20 wing imaginal discs from each genotype were collected in 20 ml PBS 1X and snap-frozen at -80C, thawed and macerated in SDS loading buffer (Invitrogen; NP008) in a volume of 40 µl, and cleared at 20.000 g for 5 min. Lysates were separated on a 12% precast SDS-PAGE (Invitrogen, NP0341 BOX). Dronc-V5-VC expression was detected in the Western blot using a goat anti-GFP antibody (1:2500; Abcam, ab6673) and beta-actin (DSHB 1:500).

Imaging of wing discs

Confocal imaging of wing imaginal discs was performed using the Olympus Fluoview FV1200 and the associated software. Fifty-five focal planes were taken per wing disc using a 40 × lens. Acquired images were processed using automated Fiji/ImageJ. Generally, Z-stacks were projected, and the channels split. Figures were produced using Adobe photoshop 2022.

Generation of genetic mosaics

Larvae yw hs-Flp1.22; MVDronc-V5-VC/salm-Gal4 were heat shocked as follows in the different experiments:

  • for 7 min at 37 °C 48–72 h after egg laying and dissected at the end of third instar larvae (LIII) (Fig. 2a).

  • for 30 min at 37 °C 48–72 h after egg laying and dissected at the end of third instar larvae (Supplementary Fig. 3a).

Larvae w; MVDronc-V5-VC/ + ; dpp-LexA/hs-mFlp5 were heat shocked as follows in the different experiments:

  • for 60 min at 37 °C 48–72 h after egg laying and dissected at the end of third instar larvae. We noticed that the recombination efficiency using hs-mFlp5 was lower than that using WT, and a longer heat-shock treatment was needed to generate genetic mosaics.

  • Sequentially 2 times for 45 min each at 37 °C 48-72 h after egg laying and dissected at the end of third instar larvae (Supplementary Fig. 3c).

Larvae w; MVDronc-V5-VC/hs-Cre; hh-QF were heat shocked as follows in the different experiments:

  • no heat shocked was applied since the hs-Cre line has demonstrated leaky expression7 (Fig. 2C).

  • for 30 min at 37 °C 48-72 h after egg laying and dissected at the end of third instar larvae (Supplementary Fig. 3b).

In all of the experiments the larvae were kept at 25 °C until the end of third instar larvae.

Source link