Sampling and ethical aspects
Samples were obtained by field collection carried out at the Salmoniculture Experimental Station of the São Paulo Fishing Institute (Campos do Jordão, Brazil). Rainbow trout (Oncorhynchus mykiss), approximately 16 weeks old, were selected for the start of bioprospecting. After capture, the animals were sacrificed respecting biosafety and anesthesia rules validated by the institutions themselves, and then, under aseptic conditions, the cecum was removed, stored in a sterile flask in thermal boxes (~ 4 °C), and transported to the laboratory for immediate analysis. This study was analyzed and approved by the Ethics Committee of São Paulo Fishing Institute (registration number 07/2020). For fish anesthesia, an aqueous solution of benzocaine (100 mg/L−1) was used until the loss of balance and reduction of opercular movements. Testing was done following guidelines and regulations.
EF was obtained from the collection belonging to the Laboratory of Bacterial Biotechnology (Universidad Nacional de la Patagonia, Argentina). The strain was isolated from starfish (order Forcipulatida) in Playa Unión, Rawson-Chubut (Patagonia, Argentina) and donated by Prof. Marisol Vallejo, National University of Patagonia San Juan Bosco (Argentina).
Bioprospecting and identification by biochemical tests and MALDI-TOF
The protocols described below were used for the isolation and identification of samples present in the cecum content of rainbow trout and starfish. The isolation was carried out according to the methods described by Schirru et al.26 with minor modifications. Samples of 25 g of excrement were homogenized in 225 mL of peptone water in a Stomacher. Serial dilutions were performed and cultivated in Man, Rogosa and Sharpe (MRS) and M17 media (BD Difco, New Jersey, USA) with cycloheximide (0.1 g/L). The plates were incubated under different temperatures (15, 25, 32 and 37 °C), for up to 48 h in anaerobic and aerobic conditions. After this period, approximately 300 CFUs were randomly chosen on each plate and replicated in the same culture medium and conditions. Then, biochemical tests were carried out for the classification of isolated microorganisms, such as Gram test (Gram method), production of Catalase (addition of hydrogen peroxide), and analysis by MALDI-TOF (Optical Microscopy and Ionization Mass Spectrometry by Laser Desorption Matrix assisted with flight time analyzer). For MALDI-TOF analysis, isolates defined as Gram-positive, Catalase-negative and with morphology corresponding to cocci and/or bacilli were selected. The protocol described by Alves et al.27 was used for this test.
Therefore, the isolated strains were grown according to their isolation conditions in plates with 1.5% MRS/M17 medium for 24 h, as previously described. Isolates and 200 μL of sterile distilled water were mixed into a 1.5 mL microtube, being homogenized for 1 min using a vortex device. A volume of 900 μL of ethanol was transferred into the tubes, and centrifugated at 12,000×g for 5 min. The supernatant was discarded, and the samples were dried at room temperature for the loss of alcohol residues. 50 μL of formic acid (70%) and 50 μL of acetonitrile were added to the tubes, with a vortex homogenization. Subsequently, a matrix of α-cyano-4-hydroxycinnamic acid was prepared as a solution saturated in 50% acetonitrile and 2.5% trifluoroacetic acid. In a steel target plate, 1μL of treated samples and 1μL of matrix solution was added for drying at room temperature. Finally, the selected strains were cryopreserved in glycerol (20% v/v) at – 80 °C. For identification by mass spectrometry, the ItrafeXtreme MALDI-TOF equipment (Bruker Daltonics, Germany) was used, operating in the positive linear ion mode. The mass spectra were acquired in a mass range of 2 to 20 kDa with ions formed by intelligent beam radiation using a frequency of 2000 Hz, PIE 100 ns, 7 kV lens. The voltages for the first and second ion sources were 25 kV and 3 kV, respectively. The bacteria were identified using the Biotyper 3.1 database. Cut-off values greater than 2 and 1.7 were used to identify species and genera, respectively27.
16S rRNA sequencing
For the identification of species at the molecular level, isolates L1, L2 and EF were subjected to partial sequencing of the 16S gene (rRNA) using the following primers: (PLB16) AGAGTTTGATCCTGGCTCAG and (MLB16) GGCTGCTGGCACGTAGTTAG. Genomic DNA was extracted using the PrepMan Ultra® kit protocol (Applied Biosystems, Carlsbad, CA, USA), following the manufacturer’s instructions. The DNA was quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) and used for amplification reactions with PCR Master Mix (Promega, San Luis Obispo, CA, USA) under the following thermal cycling conditions: 94 °C for 5 min, followed by 35 cycles at 94 °C for 1 min, 55 °C and 72 °C for 1 min, followed by a final extension of 7 min at 72 °C. PCR products were purified with a QIAquick PCR Purification kit (Qiagen, Hilden, Germany) and sequenced in both directions using a Big Dye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). After contig assembly and edition, 16S sequences were used to conduct BLAST search analysis for species identification. All sequences generated in this study were deposited in the GenBank database (Table 1).
Screening for the presence of bacteriocin genes
To assess the presence of bacteriocin-specific genes in L1, L2 and EF, a PCR reaction was performed targeting genes encoding for nisin, lacticin, lactococcin, enterocin, mundticin, and hiracin (Table 1). Amplification reactions were performed with PCR Master Mix (Promega, San Luis Obispo, CA, USA) and the same thermal cycling conditions as described above, modifying the annealing temperature when appropriate. The amplified PCR products were analyzed by 1.2% agarose gel electrophoresis at 100 V for 50 min and bands were visualized with UV light equipment.
Agar diffusion: evaluation of the antimicrobial effect of BLIS
To assess the potential antimicrobial effect of BLIS from probiotic strains and its possible ability to produce antimicrobial peptides, such as bacteriocins, BLIS sensitivity tests against important bioindicator strains were performed using the agar diffusion test. FIOCRUZ (Rio de Janeiro, RJ, Brazil) provided the pathogen S. Typhimurium 5551/16, the Fishing Institute of São Paulo (São Paulo, SP, Brazil) provided the pathogen S. agalactiae, whilst the strains L. monocytogenes CECT 934, S. aureus CECT 237 and S. Choleraesuis CECT 724 were acquired from the Spanish Type Culture Collection (CECT) (Valencia, Spain). All isolates were reactivated 24 h before the start of the experiments, followed by pre-inoculum preparation. The optical density (OD600nm 0.8) was determined, the inoculum diluted 100 times (~ 106 CFU/mL), and then incubated according to the initially described growth conditions. After a period of 24 h, the samples were centrifuged at 4470×g at 4 °C for 15 min, with 10 mL of the supernatant being removed for subsequent filtration through a 25 μm hydrophilic PVDF membrane (Filtrilo, Colombo, Brazil). The product resulting from this process was the BLIS.
Before testing for antimicrobial activity, the pH of BLIS was adjusted to ~ 6 using NaOH (1 M) and exposed to high temperatures (80 °C/10 min) to stabilize the substance and inactivate possible acids present in the sample. For the agar diffusion test, 1 mL of the inoculum of the pathogens S. Choleraesuis and S. Typhimurium was added to Petri dishes (90 × 15 mm) containing 10 mL of TSB (Difco, Michigan, USA) and 1 mL of L. monocytogenes, S. aureus or S. agalactiae on BHI agar (Difco, Michigan, USA) in a semi-solid state (supplemented with 0.75% agar). After solidification, 10 µL of the BLIS were pipetted onto the agar, and the plates were incubated for 18 h at 37 °C. Subsequently, inhibition halos were measured with the aid of digital calipers. Antimicrobial activity was expressed as arbitrary units per milliliter (AU/mL) using the formula described below (1), in which π. R2 is the area of the inhibition zone (cm2) and V is the volume (mL) of BLIS used28,29.
$$AU/mL=frac{pi .R2}{V}$$
(1)
Absorbance microplate reader
An absorbance microplate reader (BioTech, Vermont, USA) was used to assess the mode of action of BLIS against the pathogens tested at different stages of bacterial growth. For this, the BLIS and pathogens were prepared according to the pre-established conditions and incubated in a Microplate Reader (Bioteck Instruments, Vermont, USA) at 37 °C. The OD600nm was determined automatically every hour for 24 h. From this experiment, it was possible not only to confirm the results obtained in the agar diffusion test, but also to determine the stages of bacterial growth that BLIS interfere with. Subsequently, in a sterile 96-well plate (TPP, Trasadingen, Switzerland) all combinations of variables necessary for this analysis were considered, such as positive (BLIS) and negative controls (saline 0.85%), and associations between the BLIS and different pathogens28,30.
Tolerance of isolates to bile salts and low pH
The tolerance to acid pH and bile salts was evaluated based on the methodology described by Tan et al.31. L1, L2, and EF previously grown in MRS broth (~ 108 CFU/mL), were centrifuged (4,470 g), washed and resuspended in MRS with pH adjusted to 2, 2.5, 3 and 6 (negative control) with sterile 1 N HCl (Labsynth, Diadema, Brazil). The samples were then incubated at 37 °C, and 1 mL aliquots were taken after 0, 1, 2 and 3 h for CFU counting on MRS 1.5% (w/v) agar.
To evaluate the effect of bile salts, LAB were grown in MRS broth and incubated with bile salts (Sigma-Aldrich, Missouri, USA) at different concentrations (0.1%, 0.2%, 0.3% and the control, without addition) at 37 °C. Aliquots (1 mL) were taken at 0, 2, 4 and 6 h for CFU counting on MRS 1.5% (w/v) agar plates.
Tolerance of BLIS to low pH, high temperatures and proteolytic enzymes
To verify the stability of BLIS against different temperatures and pH, the method described by Todorov and Dicks32 was used. To this end, BLIS were subjected to heat treatments (30, 50, 70 or 90 °C for 1 h; 121 °C for 15 min) and pH treatments adjusted to pH 2, 4, 6, 8 or 10 with 1 N NaOH and HCl; Labsynth, Diadema, Brazil) at 30 °C for 1 h. To evaluate the proteinaceous nature of BLIS, samples were subjected to 1% (w/v) trypsin, pepsin, papain or pancreatin (Inlab, Alamar Tecno Científica Ltda, São Paulo, Brazil) and incubated at 30 °C for 2 h. After this period, the stability of BLIS was verified using the diffusion agar technique against L. monocytogenes.
Hemolytic activity
The production capacity of the extracellular protein hemolysin was evaluated in Petri dishes containing BHI agar supplemented with 5% sheep’s blood. After preparing the inoculum, the isolates were spread on the surface of the sheep’s blood agar and incubated according to the pre-established growth conditions. The activity of hemolytic hemolysin protein was confirmed by the formation of different types of halos, whose interpretation was performed by their coloring: α-hemolysin when there were greenish areas around the colonies, β-hemolysin when the zones were light-colored, and γ-hemolysin in the absence of such zones33.
Gelatinase production
For the gelatinase production test, the inoculum was cultivated on the surface of Petri dishes containing BHI supplemented with skimmed milk (1.5%) and incubated according to the respective growth conditions described above. According to Tan et al.31, a clear halo around the colony indicates a positive result for gelatinase production.
Coexistence test
This test investigates the possibility of co-cultivation between the three probiotic bacteria evaluated in this study. The tests were carried out according to the method described by Guo et al.34. Specifically, the bacteria were grown in their respective growth conditions for 24 h, and then samples were streaked perpendicularly to each other on the surface of plates containing 1.5% MRS (w/v) agar. After a 24-h incubation period, plates were examined for possible antagonistic effects.
Antibiotic resistance
Antibiotics of clinical importance were used, including vancomycin (30 μg), clindamycin (2 μg), streptomycin (10 μg), gentamicin (30 μg), chloramphenicol (30 μg), rifampicin (5 μg) and ampicillin (10 μg) (all provided by LABORCLIN, São Paulo, Brazil) loaded onto disks. Therefore, isolates were reactivated in the conditions mentioned above and, after 24 h of cultivation, bacterial growth at OD600nm was determined and adjusted to 0.8. Finally, the samples were streaked on the surface of a Petri dish containing Mueller Hinton agar (Difco, Michigan, USA) and, after drying, the antibiotic-containing disks were added to the plates. Following incubation at 37 °C for 24 h, the presence or absence of inhibition halos around the disks was interpreted35.
Adherence to intestinal epithelial cells
The method described by Jensen et al.36 was used, with minor changes. For this, DMEM medium (Vitrocell Embriolife, Campinas, Brazil) was added to 24-well culture plates with 2105 human colon adenocarcinoma cells (Caco-2; ATCC HTB-37, Manassas, USA) with low content glucose, 20% (v/v) fetal bovine serum (Vitrocell Embriolife, Campinas, Brazil) and 100 U/mL antibiotics (penicillin/streptomycin) (Sigma-Aldrich, St. Louis, USA). Then, the plates were incubated at 37 °C (humidified atmosphere, 5% CO2 and 95% air) for three days, until the appropriate growth point was reached. To perform the adhesion test, the isolated bacteria were grown for 24 h in suitable conditions and centrifuged (10,000×g for 10 min), and the pellet was resuspended in DMSO medium (without antibiotics). The monolayer formed by the growth of Caco-2 cells was washed twice with PBS before the start of the adhesion test, so that there was complete removal of the antibiotic used in the cell growth medium.
Thus, 1 mL of each bacterial culture (107 CFU/mL) was transferred individually to the wells and the plates were incubated at 37 °C for 1, 2 or 4 h, to optimize the assay. Subsequently, the cell monolayers were washed twice (PBS) to remove bacteria that were unable to adhere, and lysis of the monolayer was performed by adding PBS with 0.1% Triton-X100 (Sigma-Aldrich, St. Louis, USA). The resulting suspension (viable adherent bacteria) was diluted in different concentrations and incubated in MRS medium (pouring plate method) for 48 h. At the end of the experiment, the number of CFU/mL was determined and results were expressed as a percentage. Additionally, the ratio between the number of bacterial cells that remained adhered to the monolayer and the total number of bacterial cells added was measured.
Statistical analysis
The mean and standard deviation were used to express the results. The counts of viable bacteria were transformed into log values. The values in the tolerance test were compared using the software Statistica 12.0 (TIBCO, Palo Alto, CA, USA) applying the Tukey test with a level of significance p < 0.05.
